Incidental Mutation 'R2198:Tmprss9'
List |< first << previous [record 48 of 58] next >> last >|
ID238507
Institutional Source Beutler Lab
Gene Symbol Tmprss9
Ensembl Gene ENSMUSG00000059406
Gene Nametransmembrane protease, serine 9
SynonymsSerase-1B
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80871848-80899492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80887459 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 251 (P251L)
Ref Sequence ENSEMBL: ENSMUSP00000152034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105333] [ENSMUST00000219817]
Predicted Effect probably damaging
Transcript: ENSMUST00000105333
AA Change: P251L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406
AA Change: P251L

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219742
Predicted Effect probably damaging
Transcript: ENSMUST00000219817
AA Change: P251L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5552 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound type II serine polyprotease that is cleaved to release three different proteases. Two of the proteases are active and can be inhibited by serine protease inhibitors, and one is thought to be catalytically inactive. This gene enhances the invasive capability of pancreatic cancer cells and may be involved in cancer progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Tmprss9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tmprss9 APN 10 80894428 critical splice donor site probably null
IGL00990:Tmprss9 APN 10 80892292 missense possibly damaging 0.92
IGL01710:Tmprss9 APN 10 80897959 unclassified probably benign
IGL03075:Tmprss9 APN 10 80884029 missense possibly damaging 0.77
IGL03132:Tmprss9 APN 10 80894865 missense probably damaging 0.98
R0142:Tmprss9 UTSW 10 80894378 missense possibly damaging 0.92
R0546:Tmprss9 UTSW 10 80899323 missense probably benign 0.00
R1171:Tmprss9 UTSW 10 80879858 missense possibly damaging 0.92
R1296:Tmprss9 UTSW 10 80890445 missense probably benign 0.02
R1302:Tmprss9 UTSW 10 80895129 missense probably benign 0.00
R1498:Tmprss9 UTSW 10 80895100 missense probably benign 0.01
R1706:Tmprss9 UTSW 10 80898187 unclassified probably benign
R1851:Tmprss9 UTSW 10 80892285 missense probably damaging 0.98
R2096:Tmprss9 UTSW 10 80889434 missense probably damaging 1.00
R3783:Tmprss9 UTSW 10 80887467 missense probably damaging 1.00
R5682:Tmprss9 UTSW 10 80897373 splice site probably null
R5868:Tmprss9 UTSW 10 80882746 missense probably benign 0.03
R6006:Tmprss9 UTSW 10 80883721 missense possibly damaging 0.92
R6542:Tmprss9 UTSW 10 80888555 missense probably damaging 1.00
R6676:Tmprss9 UTSW 10 80898311 unclassified probably benign
R6718:Tmprss9 UTSW 10 80890364 missense probably benign
R7062:Tmprss9 UTSW 10 80895049 missense probably benign 0.00
R7316:Tmprss9 UTSW 10 80894979 missense probably benign 0.00
R7337:Tmprss9 UTSW 10 80882670 missense probably benign 0.00
R7624:Tmprss9 UTSW 10 80892219 missense possibly damaging 0.77
R7659:Tmprss9 UTSW 10 80893009 missense probably damaging 0.97
R7770:Tmprss9 UTSW 10 80898069 synonymous probably null
R7810:Tmprss9 UTSW 10 80897311 missense unknown
R8177:Tmprss9 UTSW 10 80895048 missense probably benign 0.00
X0062:Tmprss9 UTSW 10 80883938 splice site probably null
X0066:Tmprss9 UTSW 10 80893230 missense probably damaging 0.99
Z1176:Tmprss9 UTSW 10 80888422 missense probably damaging 0.98
Z1177:Tmprss9 UTSW 10 80887522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAGCCCCAAATAACAAGTG -3'
(R):5'- GCACATACAGATGCTAAATAAAAGCT -3'

Sequencing Primer
(F):5'- TGGGGGAATGCCTTGAACC -3'
(R):5'- CCATTCTCTATAGGAGTCAGGCATG -3'
Posted On2014-10-02