Incidental Mutation 'R2198:Mrpl54'
ID238508
Institutional Source Beutler Lab
Gene Symbol Mrpl54
Ensembl Gene ENSMUSG00000034932
Gene Namemitochondrial ribosomal protein L54
Synonyms0610008M19Rik, D10Sut1e
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81264713-81266934 bp(-) (GRCm38)
Type of Mutationunclassified (2760 bp from exon)
DNA Base Change (assembly) G to A at 81265741 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046114] [ENSMUST00000057798] [ENSMUST00000105328] [ENSMUST00000117488] [ENSMUST00000119547] [ENSMUST00000120265] [ENSMUST00000121205] [ENSMUST00000128576] [ENSMUST00000218742] [ENSMUST00000219304] [ENSMUST00000220297]
Predicted Effect probably damaging
Transcript: ENSMUST00000046114
AA Change: P62L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039951
Gene: ENSMUSG00000034932
AA Change: P62L

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Pfam:Ribosomal_L37 60 103 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057798
SMART Domains Protein: ENSMUSP00000050995
Gene: ENSMUSG00000004931

DomainStartEndE-ValueType
low complexity region 5 14 N/A INTRINSIC
low complexity region 98 120 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
PTB 213 359 3.03e-40 SMART
PDZ 400 478 3.74e-14 SMART
PDZ 492 557 9.58e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105328
SMART Domains Protein: ENSMUSP00000100965
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117488
SMART Domains Protein: ENSMUSP00000113221
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 49 107 1.37e-5 SMART
SH2 118 200 4.87e-31 SMART
TyrKc 233 476 2.88e-129 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119547
SMART Domains Protein: ENSMUSP00000113576
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 9 67 1.37e-5 SMART
SH2 78 160 4.87e-31 SMART
TyrKc 193 436 2.88e-129 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120265
SMART Domains Protein: ENSMUSP00000113666
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121205
SMART Domains Protein: ENSMUSP00000113043
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 4.87e-31 SMART
TyrKc 194 437 2.88e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128576
SMART Domains Protein: ENSMUSP00000122445
Gene: ENSMUSG00000004933

DomainStartEndE-ValueType
SH3 10 68 1.37e-5 SMART
SH2 79 161 1.55e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217754
Predicted Effect probably benign
Transcript: ENSMUST00000218742
Predicted Effect probably benign
Transcript: ENSMUST00000219304
Predicted Effect probably benign
Transcript: ENSMUST00000220297
Meta Mutation Damage Score 0.4369 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Mrpl54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02115:Mrpl54 APN 10 81265649 critical splice donor site probably null
R0534:Mrpl54 UTSW 10 81266853 missense probably damaging 1.00
R0855:Mrpl54 UTSW 10 81266925 unclassified probably benign
R1480:Mrpl54 UTSW 10 81265655 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCCATGACAAGGGTAGACG -3'
(R):5'- CAGGTCTGTGCCATAACAAGG -3'

Sequencing Primer
(F):5'- TAGACGAGCACAGCAGGCC -3'
(R):5'- TGCCATAACAAGGGACCCTGTTATG -3'
Posted On2014-10-02