Incidental Mutation 'R2198:Tle2'
ID 238509
Institutional Source Beutler Lab
Gene Symbol Tle2
Ensembl Gene ENSMUSG00000034771
Gene Name transducin-like enhancer of split 2
Synonyms Grg2
MMRRC Submission 040200-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R2198 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 81410395-81426679 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 81426147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 727 (V727A)
Ref Sequence ENSEMBL: ENSMUSP00000117453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000146358] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000146916]
AlphaFold Q9WVB2
Predicted Effect probably benign
Transcript: ENSMUST00000072020
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect unknown
Transcript: ENSMUST00000131411
AA Change: V113A
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771
AA Change: V113A

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146358
AA Change: V762A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771
AA Change: V762A

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135211
AA Change: V727A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771
AA Change: V727A

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect probably benign
Transcript: ENSMUST00000142948
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151470
Meta Mutation Damage Score 0.2118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T C 14: 66,875,385 (GRCm39) I120T probably damaging Het
Akr1c21 C T 13: 4,627,464 (GRCm39) P186L probably damaging Het
Alpk2 T C 18: 65,483,255 (GRCm39) K251R probably benign Het
Ank2 T C 3: 126,728,226 (GRCm39) E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,147,493 (GRCm39) probably null Het
Cacna2d4 T C 6: 119,324,220 (GRCm39) probably benign Het
Carf G A 1: 60,180,643 (GRCm39) R355H probably damaging Het
Cdh20 A T 1: 104,875,047 (GRCm39) probably null Het
Celf6 G T 9: 59,510,622 (GRCm39) L169F possibly damaging Het
Cep295nl A T 11: 118,223,419 (GRCm39) I475N probably benign Het
Chdh T A 14: 29,753,489 (GRCm39) S133T possibly damaging Het
Cnot6l C T 5: 96,227,800 (GRCm39) D478N possibly damaging Het
Ctnna3 C A 10: 64,838,524 (GRCm39) T867K probably benign Het
Ctse T G 1: 131,600,185 (GRCm39) Y311* probably null Het
Ddx60 T A 8: 62,411,097 (GRCm39) M453K possibly damaging Het
Dnah9 A G 11: 65,750,325 (GRCm39) F3927L possibly damaging Het
Dsg4 T C 18: 20,594,499 (GRCm39) S543P probably benign Het
Dspp A T 5: 104,323,567 (GRCm39) T237S probably benign Het
Eml6 T G 11: 29,800,935 (GRCm39) H357P probably benign Het
Epha3 T C 16: 63,664,507 (GRCm39) I38V possibly damaging Het
Erap1 C T 13: 74,794,806 (GRCm39) T155I probably damaging Het
Erh T C 12: 80,689,559 (GRCm39) probably benign Het
F5 A T 1: 164,034,603 (GRCm39) K1834M probably damaging Het
Fyn A G 10: 39,405,541 (GRCm39) E269G probably benign Het
Gm4884 A G 7: 40,690,229 (GRCm39) T42A probably benign Het
Grm1 T G 10: 10,658,520 (GRCm39) R323S probably damaging Het
Gstt4 T C 10: 75,658,235 (GRCm39) D8G probably damaging Het
Gvin-ps3 T A 7: 105,682,758 (GRCm39) M166L probably benign Het
Ldlr A G 9: 21,643,698 (GRCm39) D94G probably damaging Het
Mrpl54 G A 10: 81,101,575 (GRCm39) probably null Het
Naip2 A T 13: 100,289,100 (GRCm39) F1210Y probably damaging Het
Nifk A G 1: 118,257,130 (GRCm39) R88G probably benign Het
Nlgn1 C T 3: 25,487,925 (GRCm39) M803I probably damaging Het
Or2r11 A G 6: 42,437,950 (GRCm39) M1T probably null Het
Or2y16 C T 11: 49,334,786 (GRCm39) S36F probably benign Het
Or6c88 T A 10: 129,406,915 (GRCm39) Y130* probably null Het
Or8g18 G A 9: 39,149,048 (GRCm39) T224I possibly damaging Het
Pip4k2a A T 2: 18,852,466 (GRCm39) M272K probably damaging Het
Ppp1cb G T 5: 32,640,704 (GRCm39) C139F probably damaging Het
Rad23b G A 4: 55,385,497 (GRCm39) G345R possibly damaging Het
Shc4 A T 2: 125,481,266 (GRCm39) V548E possibly damaging Het
Slc26a9 A G 1: 131,691,001 (GRCm39) probably benign Het
Slc8a1 T A 17: 81,715,685 (GRCm39) K783* probably null Het
Sobp A C 10: 42,898,520 (GRCm39) I355S possibly damaging Het
Thbs4 A G 13: 92,899,779 (GRCm39) Y491H possibly damaging Het
Tmprss9 C T 10: 80,723,293 (GRCm39) P251L probably damaging Het
Tnks A T 8: 35,315,803 (GRCm39) D994E probably benign Het
Tnks C T 8: 35,340,221 (GRCm39) D466N probably benign Het
Tonsl A G 15: 76,520,872 (GRCm39) F394L probably benign Het
Trpa1 T A 1: 14,980,970 (GRCm39) Y144F probably benign Het
Usp22 A G 11: 61,050,163 (GRCm39) F324S probably damaging Het
Vmn1r78 G T 7: 11,886,487 (GRCm39) V33F probably benign Het
Wdr81 C T 11: 75,336,907 (GRCm39) R1494Q probably benign Het
Wdr87-ps G T 7: 29,226,697 (GRCm39) noncoding transcript Het
Zc3h14 G A 12: 98,719,068 (GRCm39) M144I probably damaging Het
Zc3h14 G A 12: 98,719,069 (GRCm39) V145M possibly damaging Het
Zfp82 T C 7: 29,756,936 (GRCm39) T49A probably benign Het
Other mutations in Tle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Tle2 APN 10 81,417,573 (GRCm39) missense probably benign 0.12
IGL02651:Tle2 APN 10 81,422,723 (GRCm39) missense probably damaging 1.00
IGL02809:Tle2 APN 10 81,422,196 (GRCm39) splice site probably null
IGL03235:Tle2 APN 10 81,422,085 (GRCm39) missense probably benign 0.22
IGL03307:Tle2 APN 10 81,426,074 (GRCm39) missense probably damaging 1.00
foxbat UTSW 10 81,422,147 (GRCm39) nonsense probably null
Illyushin UTSW 10 81,424,706 (GRCm39) missense probably damaging 1.00
R5011_Tle2_517 UTSW 10 81,420,531 (GRCm39) missense probably damaging 1.00
PIT4515001:Tle2 UTSW 10 81,422,964 (GRCm39) missense possibly damaging 0.72
R0394:Tle2 UTSW 10 81,413,482 (GRCm39) missense probably damaging 1.00
R0744:Tle2 UTSW 10 81,424,781 (GRCm39) missense probably damaging 1.00
R0826:Tle2 UTSW 10 81,422,148 (GRCm39) missense possibly damaging 0.95
R0833:Tle2 UTSW 10 81,424,781 (GRCm39) missense probably damaging 1.00
R1796:Tle2 UTSW 10 81,425,331 (GRCm39) critical splice donor site probably null
R2067:Tle2 UTSW 10 81,416,385 (GRCm39) missense probably damaging 1.00
R2184:Tle2 UTSW 10 81,426,111 (GRCm39) missense probably damaging 1.00
R4439:Tle2 UTSW 10 81,417,516 (GRCm39) missense possibly damaging 0.62
R4440:Tle2 UTSW 10 81,417,516 (GRCm39) missense possibly damaging 0.62
R4441:Tle2 UTSW 10 81,417,516 (GRCm39) missense possibly damaging 0.62
R4513:Tle2 UTSW 10 81,423,394 (GRCm39) missense probably damaging 1.00
R4839:Tle2 UTSW 10 81,413,518 (GRCm39) missense probably damaging 1.00
R4863:Tle2 UTSW 10 81,424,725 (GRCm39) missense possibly damaging 0.88
R5011:Tle2 UTSW 10 81,420,531 (GRCm39) missense probably damaging 1.00
R5505:Tle2 UTSW 10 81,417,574 (GRCm39) missense probably benign 0.00
R5538:Tle2 UTSW 10 81,416,418 (GRCm39) missense probably damaging 1.00
R5790:Tle2 UTSW 10 81,426,149 (GRCm39) missense probably damaging 1.00
R5917:Tle2 UTSW 10 81,416,750 (GRCm39) critical splice donor site probably null
R6176:Tle2 UTSW 10 81,423,168 (GRCm39) missense probably damaging 0.99
R6200:Tle2 UTSW 10 81,424,706 (GRCm39) missense probably damaging 1.00
R6914:Tle2 UTSW 10 81,422,190 (GRCm39) missense probably damaging 1.00
R7367:Tle2 UTSW 10 81,416,152 (GRCm39) missense probably damaging 0.99
R7600:Tle2 UTSW 10 81,422,147 (GRCm39) nonsense probably null
R7729:Tle2 UTSW 10 81,422,981 (GRCm39) missense probably damaging 0.99
R8333:Tle2 UTSW 10 81,413,518 (GRCm39) missense probably damaging 1.00
R8511:Tle2 UTSW 10 81,423,830 (GRCm39) missense probably damaging 1.00
R9562:Tle2 UTSW 10 81,417,567 (GRCm39) missense probably benign 0.11
R9565:Tle2 UTSW 10 81,417,567 (GRCm39) missense probably benign 0.11
T0970:Tle2 UTSW 10 81,416,119 (GRCm39) missense possibly damaging 0.71
Z1177:Tle2 UTSW 10 81,418,280 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCTTTGTTGTCCTCCAAG -3'
(R):5'- CACTCTGAAAATTGGGGCAAAG -3'

Sequencing Primer
(F):5'- GTTGTCCTCCAAGCCCCATG -3'
(R):5'- TCACCTGTACGCTTCACACAC -3'
Posted On 2014-10-02