Incidental Mutation 'R2198:Tle2'
List |< first << previous [record 47 of 58] next >> last >|
ID238509
Institutional Source Beutler Lab
Gene Symbol Tle2
Ensembl Gene ENSMUSG00000034771
Gene Nametransducin-like enhancer of split 2
SynonymsGrg2
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81574561-81590845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81590313 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 727 (V727A)
Ref Sequence ENSEMBL: ENSMUSP00000117453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000146358] [ENSMUST00000146916]
Predicted Effect probably benign
Transcript: ENSMUST00000072020
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect unknown
Transcript: ENSMUST00000131411
AA Change: V113A
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771
AA Change: V113A

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect probably damaging
Transcript: ENSMUST00000135211
AA Change: V727A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771
AA Change: V727A

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141913
Predicted Effect probably benign
Transcript: ENSMUST00000142948
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect probably damaging
Transcript: ENSMUST00000146358
AA Change: V762A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771
AA Change: V762A

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Meta Mutation Damage Score 0.2118 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Tle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Tle2 APN 10 81581739 missense probably benign 0.12
IGL02651:Tle2 APN 10 81586889 missense probably damaging 1.00
IGL02809:Tle2 APN 10 81586362 unclassified probably null
IGL03235:Tle2 APN 10 81586251 missense probably benign 0.22
IGL03307:Tle2 APN 10 81590240 missense probably damaging 1.00
PIT4515001:Tle2 UTSW 10 81587130 missense possibly damaging 0.72
R0394:Tle2 UTSW 10 81577648 missense probably damaging 1.00
R0744:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R0826:Tle2 UTSW 10 81586314 missense possibly damaging 0.95
R0833:Tle2 UTSW 10 81588947 missense probably damaging 1.00
R1796:Tle2 UTSW 10 81589497 critical splice donor site probably null
R2067:Tle2 UTSW 10 81580551 missense probably damaging 1.00
R2184:Tle2 UTSW 10 81590277 missense probably damaging 1.00
R4439:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4440:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4441:Tle2 UTSW 10 81581682 missense possibly damaging 0.62
R4513:Tle2 UTSW 10 81587560 missense probably damaging 1.00
R4839:Tle2 UTSW 10 81577684 missense probably damaging 1.00
R4863:Tle2 UTSW 10 81588891 missense possibly damaging 0.88
R5011:Tle2 UTSW 10 81584697 missense probably damaging 1.00
R5505:Tle2 UTSW 10 81581740 missense probably benign 0.00
R5538:Tle2 UTSW 10 81580584 missense probably damaging 1.00
R5790:Tle2 UTSW 10 81590315 missense probably damaging 1.00
R5917:Tle2 UTSW 10 81580916 critical splice donor site probably null
R6176:Tle2 UTSW 10 81587334 missense probably damaging 0.99
R6200:Tle2 UTSW 10 81588872 missense probably damaging 1.00
R6914:Tle2 UTSW 10 81586356 missense probably damaging 1.00
R7367:Tle2 UTSW 10 81580318 missense probably damaging 0.99
R7600:Tle2 UTSW 10 81586313 nonsense probably null
R7729:Tle2 UTSW 10 81587147 missense probably damaging 0.99
T0970:Tle2 UTSW 10 81580285 missense possibly damaging 0.71
Z1177:Tle2 UTSW 10 81582446 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCTTTGTTGTCCTCCAAG -3'
(R):5'- CACTCTGAAAATTGGGGCAAAG -3'

Sequencing Primer
(F):5'- GTTGTCCTCCAAGCCCCATG -3'
(R):5'- TCACCTGTACGCTTCACACAC -3'
Posted On2014-10-02