Incidental Mutation 'R2198:Olfr1388'
ID238512
Institutional Source Beutler Lab
Gene Symbol Olfr1388
Ensembl Gene ENSMUSG00000047702
Gene Nameolfactory receptor 1388
SynonymsGA_x6K02T2QP88-5991012-5990077, MOR256-28
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49436624-49446103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49443959 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 36 (S36F)
Ref Sequence ENSEMBL: ENSMUSP00000150160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055584] [ENSMUST00000215226]
Predicted Effect probably benign
Transcript: ENSMUST00000055584
AA Change: S36F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000053834
Gene: ENSMUSG00000047702
AA Change: S36F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 3.7e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 154 9.8e-7 PFAM
Pfam:7tm_1 41 289 7.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215226
AA Change: S36F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.1267 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ctse T G 1: 131,672,447 Y311* probably null Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Olfr1388
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Olfr1388 APN 11 49444374 missense probably damaging 1.00
IGL01346:Olfr1388 APN 11 49444768 missense probably benign 0.00
IGL01943:Olfr1388 APN 11 49444188 nonsense probably null
IGL03343:Olfr1388 APN 11 49444243 missense probably damaging 0.97
R1530:Olfr1388 UTSW 11 49443905 missense probably benign 0.27
R1699:Olfr1388 UTSW 11 49444289 missense possibly damaging 0.88
R2059:Olfr1388 UTSW 11 49444451 missense probably damaging 0.99
R4782:Olfr1388 UTSW 11 49443869 missense probably benign 0.00
R4885:Olfr1388 UTSW 11 49444622 missense probably damaging 0.97
R4966:Olfr1388 UTSW 11 49444118 missense possibly damaging 0.94
R5165:Olfr1388 UTSW 11 49444376 missense probably damaging 1.00
R5173:Olfr1388 UTSW 11 49443886 missense probably benign 0.12
R5667:Olfr1388 UTSW 11 49444313 missense probably benign 0.00
R5671:Olfr1388 UTSW 11 49444313 missense probably benign 0.00
R5836:Olfr1388 UTSW 11 49444526 missense probably damaging 1.00
R6173:Olfr1388 UTSW 11 49444472 missense probably benign 0.01
R6801:Olfr1388 UTSW 11 49444342 missense probably benign 0.10
R6864:Olfr1388 UTSW 11 49443940 missense probably benign
R6876:Olfr1388 UTSW 11 49444241 missense probably damaging 1.00
R7386:Olfr1388 UTSW 11 49444400 missense possibly damaging 0.95
R8119:Olfr1388 UTSW 11 49444126 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTGGAAACCCACACTACTCG -3'
(R):5'- ACACTCTGTAGATGCCAGGG -3'

Sequencing Primer
(F):5'- CACTACTCGTTGAAAGCATTGC -3'
(R):5'- ACACACCTTTCATAGCTGATGG -3'
Posted On2014-10-02