Incidental Mutation 'R2198:Dsg4'
ID 238531
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 040200-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.626) question?
Stock # R2198 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20594499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 543 (S543P)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably benign
Transcript: ENSMUST00000019426
AA Change: S543P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: S543P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.1159 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1a T C 14: 66,875,385 (GRCm39) I120T probably damaging Het
Akr1c21 C T 13: 4,627,464 (GRCm39) P186L probably damaging Het
Alpk2 T C 18: 65,483,255 (GRCm39) K251R probably benign Het
Ank2 T C 3: 126,728,226 (GRCm39) E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,147,493 (GRCm39) probably null Het
Cacna2d4 T C 6: 119,324,220 (GRCm39) probably benign Het
Carf G A 1: 60,180,643 (GRCm39) R355H probably damaging Het
Cdh20 A T 1: 104,875,047 (GRCm39) probably null Het
Celf6 G T 9: 59,510,622 (GRCm39) L169F possibly damaging Het
Cep295nl A T 11: 118,223,419 (GRCm39) I475N probably benign Het
Chdh T A 14: 29,753,489 (GRCm39) S133T possibly damaging Het
Cnot6l C T 5: 96,227,800 (GRCm39) D478N possibly damaging Het
Ctnna3 C A 10: 64,838,524 (GRCm39) T867K probably benign Het
Ctse T G 1: 131,600,185 (GRCm39) Y311* probably null Het
Ddx60 T A 8: 62,411,097 (GRCm39) M453K possibly damaging Het
Dnah9 A G 11: 65,750,325 (GRCm39) F3927L possibly damaging Het
Dspp A T 5: 104,323,567 (GRCm39) T237S probably benign Het
Eml6 T G 11: 29,800,935 (GRCm39) H357P probably benign Het
Epha3 T C 16: 63,664,507 (GRCm39) I38V possibly damaging Het
Erap1 C T 13: 74,794,806 (GRCm39) T155I probably damaging Het
Erh T C 12: 80,689,559 (GRCm39) probably benign Het
F5 A T 1: 164,034,603 (GRCm39) K1834M probably damaging Het
Fyn A G 10: 39,405,541 (GRCm39) E269G probably benign Het
Gm4884 A G 7: 40,690,229 (GRCm39) T42A probably benign Het
Grm1 T G 10: 10,658,520 (GRCm39) R323S probably damaging Het
Gstt4 T C 10: 75,658,235 (GRCm39) D8G probably damaging Het
Gvin-ps3 T A 7: 105,682,758 (GRCm39) M166L probably benign Het
Ldlr A G 9: 21,643,698 (GRCm39) D94G probably damaging Het
Mrpl54 G A 10: 81,101,575 (GRCm39) probably null Het
Naip2 A T 13: 100,289,100 (GRCm39) F1210Y probably damaging Het
Nifk A G 1: 118,257,130 (GRCm39) R88G probably benign Het
Nlgn1 C T 3: 25,487,925 (GRCm39) M803I probably damaging Het
Or2r11 A G 6: 42,437,950 (GRCm39) M1T probably null Het
Or2y16 C T 11: 49,334,786 (GRCm39) S36F probably benign Het
Or6c88 T A 10: 129,406,915 (GRCm39) Y130* probably null Het
Or8g18 G A 9: 39,149,048 (GRCm39) T224I possibly damaging Het
Pip4k2a A T 2: 18,852,466 (GRCm39) M272K probably damaging Het
Ppp1cb G T 5: 32,640,704 (GRCm39) C139F probably damaging Het
Rad23b G A 4: 55,385,497 (GRCm39) G345R possibly damaging Het
Shc4 A T 2: 125,481,266 (GRCm39) V548E possibly damaging Het
Slc26a9 A G 1: 131,691,001 (GRCm39) probably benign Het
Slc8a1 T A 17: 81,715,685 (GRCm39) K783* probably null Het
Sobp A C 10: 42,898,520 (GRCm39) I355S possibly damaging Het
Thbs4 A G 13: 92,899,779 (GRCm39) Y491H possibly damaging Het
Tle2 T C 10: 81,426,147 (GRCm39) V727A probably damaging Het
Tmprss9 C T 10: 80,723,293 (GRCm39) P251L probably damaging Het
Tnks A T 8: 35,315,803 (GRCm39) D994E probably benign Het
Tnks C T 8: 35,340,221 (GRCm39) D466N probably benign Het
Tonsl A G 15: 76,520,872 (GRCm39) F394L probably benign Het
Trpa1 T A 1: 14,980,970 (GRCm39) Y144F probably benign Het
Usp22 A G 11: 61,050,163 (GRCm39) F324S probably damaging Het
Vmn1r78 G T 7: 11,886,487 (GRCm39) V33F probably benign Het
Wdr81 C T 11: 75,336,907 (GRCm39) R1494Q probably benign Het
Wdr87-ps G T 7: 29,226,697 (GRCm39) noncoding transcript Het
Zc3h14 G A 12: 98,719,068 (GRCm39) M144I probably damaging Het
Zc3h14 G A 12: 98,719,069 (GRCm39) V145M possibly damaging Het
Zfp82 T C 7: 29,756,936 (GRCm39) T49A probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8554:Dsg4 UTSW 18 20,586,100 (GRCm39) missense probably damaging 1.00
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCATTGAGATTCCTGATGCC -3'
(R):5'- AGCAACTAGGATGGTTTTGAACTCAC -3'

Sequencing Primer
(F):5'- GAGATTCCTGATGCCAACGATTACTG -3'
(R):5'- TTGAACTCACAGATATCTACCTGC -3'
Posted On 2014-10-02