Mutagenetix > Incidental Mutation

Incidental Mutation 'R2199:Thsd7b'

238534

Institutional Source

Beutler Lab

Gene Symbol

Thsd7b

Ensembl Gene

ENSMUSG00000042581

Gene Name

thrombospondin, type I, domain containing 7B

Synonyms

1700074E13Rik, D130067I03Rik

MMRRC Submission

040201-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R2199 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129273302-130219278 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130218158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1601 (Y1601C)

Ref Sequence

ENSEMBL: ENSMUSP00000073220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073527]

AlphaFold

Q6P4U0

Predicted Effect

probably benign
Transcript: ENSMUST00000073527
AA Change: Y1601C

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: Y1601C

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
Blast:TSP1	43	98	5e-29	BLAST
Blast:TSP1	122	177	9e-24	BLAST
TSP1	182	233	2.47e-9	SMART
TSP1	339	399	7e-9	SMART
Blast:TSP1	402	482	2e-27	BLAST
TSP1	487	543	2.12e-1	SMART
TSP1	604	661	3.9e-7	SMART
TSP1	664	735	2.73e-2	SMART
TSP1	740	796	1.01e-5	SMART
Blast:TSP1	799	869	6e-35	BLAST
TSP1	874	922	9.68e-3	SMART
TSP1	952	999	2.42e0	SMART
TSP1	1004	1059	3.96e-8	SMART
TSP1	1062	1126	1.73e0	SMART
TSP1	1131	1182	6.05e-4	SMART
TSP1	1185	1246	9.52e-1	SMART
TSP1	1251	1303	3.21e-8	SMART
TSP1	1304	1369	5.52e-1	SMART
TSP1	1374	1432	3.92e-2	SMART
transmembrane domain	1558	1580	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140834

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,335,624	I119V	probably benign	Het
Arfgap2	T	A	2: 91,265,692		probably null	Het
Ccm2	T	C	11: 6,590,790	V216A	probably damaging	Het
Ctdspl2	T	C	2: 121,987,029		probably null	Het
Dmxl2	T	C	9: 54,376,243	T2769A	probably benign	Het
Dnah3	C	T	7: 119,951,569	V3165M	possibly damaging	Het
Dnajc1	A	C	2: 18,308,899	F137C	probably damaging	Het
Gli2	A	T	1: 118,837,648	D924E	possibly damaging	Het
Gnrhr	T	C	5: 86,197,818	N3S	probably benign	Het
Grhl1	G	T	12: 24,612,170	R536L	probably damaging	Het
Hormad1	T	C	3: 95,567,722		probably null	Het
Il20	T	A	1: 130,910,739	I74L	probably benign	Het
Ints11	A	G	4: 155,875,281	K115R	probably benign	Het
Irx4	A	T	13: 73,265,601	E63D	probably benign	Het
Itch	A	C	2: 155,202,221	Q482P	probably benign	Het
Kctd8	C	A	5: 69,341,245	M19I	probably benign	Het
Klhl31	T	C	9: 77,650,101	L33P	probably damaging	Het
Lrp1	A	T	10: 127,546,840	C3691S	probably damaging	Het
Lrrc39	A	G	3: 116,570,961	D167G	probably damaging	Het
Lrrd1	A	T	5: 3,866,478	I832L	possibly damaging	Het
Lrriq1	A	G	10: 103,068,913	V1620A	probably damaging	Het
Ltbr	T	C	6: 125,312,061	K213E	probably benign	Het
Megf8	T	A	7: 25,339,614	D883E	possibly damaging	Het
Nmt1	T	A	11: 103,063,856	S405T	probably damaging	Het
Nsd3	G	T	8: 25,666,057	V547F	probably damaging	Het
Olfr1215	A	G	2: 89,001,550	V246A	probably damaging	Het
Olfr828	C	A	9: 18,815,923	V124F	probably damaging	Het
Otud7a	A	G	7: 63,757,656	K569R	possibly damaging	Het
Otud7b	A	G	3: 96,155,772	Y776C	probably damaging	Het
Pcdh15	T	C	10: 74,170,509	I73T	probably damaging	Het
Rnf213	A	T	11: 119,460,009	H3890L	probably benign	Het
Sall3	T	C	18: 80,971,870	T948A	probably benign	Het
Slc44a3	T	C	3: 121,513,744	I198V	probably benign	Het
Slc9a3r2	T	C	17: 24,640,596	E174G	probably null	Het
Smg7	C	A	1: 152,854,328	D405Y	probably damaging	Het
Synpo2l	A	G	14: 20,661,919	L211S	probably benign	Het
Traf4	T	C	11: 78,159,980	Y450C	probably damaging	Het
Trpv1	A	G	11: 73,240,251	K239E	probably damaging	Het
Ttn	C	T	2: 76,754,806	G20302S	probably damaging	Het
Ube2o	A	G	11: 116,544,745	S406P	probably benign	Het
Xrn2	C	T	2: 147,024,750	A80V	probably damaging	Het
Zfp616	C	T	11: 74,084,630	T575I	possibly damaging	Het

Other mutations in Thsd7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Thsd7b	APN	1	129595834	missense	probably damaging	1.00
IGL00850:Thsd7b	APN	1	130165077	missense	probably benign	0.00
IGL00987:Thsd7b	APN	1	129613279	missense	probably damaging	1.00
IGL01068:Thsd7b	APN	1	129596146	missense	probably damaging	1.00
IGL01091:Thsd7b	APN	1	129776334	missense	probably benign	0.29
IGL01535:Thsd7b	APN	1	129678217	missense	possibly damaging	0.64
IGL01560:Thsd7b	APN	1	130218181	utr 3 prime	probably benign
IGL01701:Thsd7b	APN	1	129430928	missense	probably benign	0.07
IGL01775:Thsd7b	APN	1	129628939	missense	probably damaging	0.99
IGL02077:Thsd7b	APN	1	129816682	missense	probably damaging	1.00
IGL02338:Thsd7b	APN	1	129595771	missense	probably damaging	1.00
IGL02340:Thsd7b	APN	1	130159632	missense	probably benign	0.01
IGL02404:Thsd7b	APN	1	129613151	missense	probably damaging	1.00
IGL02519:Thsd7b	APN	1	129613195	missense	probably benign	0.22
IGL02543:Thsd7b	APN	1	130165103	missense	probably benign	0.03
IGL02740:Thsd7b	APN	1	129613127	missense	probably damaging	0.99
IGL02793:Thsd7b	APN	1	129951393	missense	probably damaging	1.00
IGL02875:Thsd7b	APN	1	129951393	missense	probably damaging	1.00
IGL02986:Thsd7b	APN	1	129915615	missense	probably benign	0.01
IGL03108:Thsd7b	APN	1	130210276	missense	probably damaging	1.00
IGL03114:Thsd7b	APN	1	130188551	missense	probably benign	0.00
IGL03195:Thsd7b	APN	1	129628909	missense	probably damaging	1.00
IGL03291:Thsd7b	APN	1	129760355	missense	possibly damaging	0.94
IGL03397:Thsd7b	APN	1	129596164	missense	probably benign	0.17
IGL03399:Thsd7b	APN	1	129628885	missense	probably damaging	1.00
R0184:Thsd7b	UTSW	1	129430964	missense	probably benign	0.00
R0277:Thsd7b	UTSW	1	130195263	missense	probably benign	0.00
R0526:Thsd7b	UTSW	1	129951392	missense	probably damaging	1.00
R0633:Thsd7b	UTSW	1	130188526	missense	possibly damaging	0.78
R0746:Thsd7b	UTSW	1	130188531	missense	probably benign	0.00
R0784:Thsd7b	UTSW	1	129595359	splice site	probably benign
R1158:Thsd7b	UTSW	1	130189935	splice site	probably null
R1267:Thsd7b	UTSW	1	129628840	splice site	probably null
R1375:Thsd7b	UTSW	1	130159686	missense	probably damaging	1.00
R1565:Thsd7b	UTSW	1	129596041	missense	possibly damaging	0.94
R1728:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1728:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1728:Thsd7b	UTSW	1	129678183	missense	probably benign
R1728:Thsd7b	UTSW	1	130116631	missense	probably benign
R1729:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1729:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1729:Thsd7b	UTSW	1	129678183	missense	probably benign
R1729:Thsd7b	UTSW	1	130116631	missense	probably benign
R1730:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1730:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1730:Thsd7b	UTSW	1	129678183	missense	probably benign
R1730:Thsd7b	UTSW	1	130116631	missense	probably benign
R1739:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1739:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1739:Thsd7b	UTSW	1	129678183	missense	probably benign
R1739:Thsd7b	UTSW	1	130116631	missense	probably benign
R1762:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1762:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1762:Thsd7b	UTSW	1	129678183	missense	probably benign
R1762:Thsd7b	UTSW	1	130103076	missense	possibly damaging	0.92
R1762:Thsd7b	UTSW	1	130116631	missense	probably benign
R1783:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1783:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1783:Thsd7b	UTSW	1	129678183	missense	probably benign
R1783:Thsd7b	UTSW	1	130116631	missense	probably benign
R1784:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1784:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1784:Thsd7b	UTSW	1	129678183	missense	probably benign
R1784:Thsd7b	UTSW	1	130116631	missense	probably benign
R1785:Thsd7b	UTSW	1	129628891	missense	probably damaging	1.00
R1785:Thsd7b	UTSW	1	129667937	missense	probably benign	0.00
R1785:Thsd7b	UTSW	1	129678183	missense	probably benign
R1785:Thsd7b	UTSW	1	130116631	missense	probably benign
R1812:Thsd7b	UTSW	1	129758610	missense	probably damaging	1.00
R1846:Thsd7b	UTSW	1	129613256	missense	probably damaging	1.00
R1908:Thsd7b	UTSW	1	129678109	missense	probably damaging	0.99
R1996:Thsd7b	UTSW	1	129758451	nonsense	probably null
R2483:Thsd7b	UTSW	1	130103072	missense	probably damaging	1.00
R2919:Thsd7b	UTSW	1	130189850	splice site	probably benign
R2935:Thsd7b	UTSW	1	129678087	missense	possibly damaging	0.83
R3113:Thsd7b	UTSW	1	130049862	missense	probably benign	0.23
R3236:Thsd7b	UTSW	1	130218118	nonsense	probably null
R3745:Thsd7b	UTSW	1	129678241	missense	probably benign	0.04
R3877:Thsd7b	UTSW	1	130190182	missense	possibly damaging	0.92
R3880:Thsd7b	UTSW	1	129595370	missense	probably damaging	1.00
R4110:Thsd7b	UTSW	1	130116619	missense	probably benign	0.18
R4112:Thsd7b	UTSW	1	130116619	missense	probably benign	0.18
R4255:Thsd7b	UTSW	1	129760287	missense	possibly damaging	0.79
R4621:Thsd7b	UTSW	1	129430915	missense	possibly damaging	0.47
R4703:Thsd7b	UTSW	1	130049909	intron	probably benign
R4732:Thsd7b	UTSW	1	129613186	missense	probably damaging	1.00
R4733:Thsd7b	UTSW	1	129613186	missense	probably damaging	1.00
R4755:Thsd7b	UTSW	1	130210264	missense	probably benign	0.01
R4805:Thsd7b	UTSW	1	130188539	missense	probably benign	0.04
R4840:Thsd7b	UTSW	1	129595844	missense	probably benign	0.00
R4879:Thsd7b	UTSW	1	130188499	missense	possibly damaging	0.62
R4936:Thsd7b	UTSW	1	129678145	missense	probably benign	0.00
R4972:Thsd7b	UTSW	1	130188572	missense	probably damaging	0.97
R5304:Thsd7b	UTSW	1	129678243	nonsense	probably null
R5422:Thsd7b	UTSW	1	129921334	missense	probably benign	0.41
R5495:Thsd7b	UTSW	1	129595833	missense	probably damaging	1.00
R5598:Thsd7b	UTSW	1	129595841	missense	probably damaging	1.00
R5620:Thsd7b	UTSW	1	130162936	critical splice donor site	probably null
R5638:Thsd7b	UTSW	1	129595533	missense	probably benign	0.00
R5640:Thsd7b	UTSW	1	130116671	nonsense	probably null
R5655:Thsd7b	UTSW	1	129628934	splice site	probably null
R5711:Thsd7b	UTSW	1	129760402	missense	probably damaging	1.00
R5823:Thsd7b	UTSW	1	129678084	missense	probably benign	0.00
R5888:Thsd7b	UTSW	1	130210320	nonsense	probably null
R5932:Thsd7b	UTSW	1	129430838	missense	probably benign
R6243:Thsd7b	UTSW	1	130162862	missense	probably benign	0.21
R6258:Thsd7b	UTSW	1	129667918	missense	probably benign
R6260:Thsd7b	UTSW	1	129667918	missense	probably benign
R6399:Thsd7b	UTSW	1	129816648	missense	probably benign	0.13
R6437:Thsd7b	UTSW	1	129816682	missense	probably damaging	1.00
R6719:Thsd7b	UTSW	1	130159714	splice site	probably null
R6785:Thsd7b	UTSW	1	129430907	missense	probably damaging	0.99
R7304:Thsd7b	UTSW	1	130103153	missense	probably benign	0.01
R7334:Thsd7b	UTSW	1	130195275	missense	probably benign	0.00
R7414:Thsd7b	UTSW	1	129628980	missense	probably damaging	0.99
R7673:Thsd7b	UTSW	1	129915750	splice site	probably null
R7683:Thsd7b	UTSW	1	129595946	missense	probably damaging	0.99
R7861:Thsd7b	UTSW	1	130159698	missense	probably benign	0.00
R8145:Thsd7b	UTSW	1	129760299	missense	probably damaging	1.00
R8241:Thsd7b	UTSW	1	130189951	missense	probably damaging	1.00
R8296:Thsd7b	UTSW	1	129595456	missense	probably benign	0.01
R8355:Thsd7b	UTSW	1	129595879	missense	probably damaging	1.00
R8507:Thsd7b	UTSW	1	129678053	missense	probably benign	0.21
R8520:Thsd7b	UTSW	1	129921420	missense	probably benign	0.07
R8555:Thsd7b	UTSW	1	129595454	missense	probably damaging	1.00
R8682:Thsd7b	UTSW	1	129760274	nonsense	probably null
R8981:Thsd7b	UTSW	1	129595450	missense	possibly damaging	0.88
R9029:Thsd7b	UTSW	1	130159689	missense	probably damaging	1.00
R9133:Thsd7b	UTSW	1	129915645	missense	probably benign	0.18
R9194:Thsd7b	UTSW	1	129915634	missense	possibly damaging	0.78
R9229:Thsd7b	UTSW	1	129921290	missense	probably damaging	1.00
R9239:Thsd7b	UTSW	1	130159716	critical splice donor site	probably null
R9460:Thsd7b	UTSW	1	130162937	critical splice donor site	probably null
R9466:Thsd7b	UTSW	1	130195129	missense	probably benign
R9588:Thsd7b	UTSW	1	130180486	missense	probably damaging	1.00
X0027:Thsd7b	UTSW	1	129596072	missense	probably benign	0.00
Z1176:Thsd7b	UTSW	1	129595516	missense	probably damaging	0.98
Z1176:Thsd7b	UTSW	1	129595660	missense	probably benign	0.01
Z1176:Thsd7b	UTSW	1	129628911	missense	probably benign	0.17
Z1176:Thsd7b	UTSW	1	130180424	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AGCTATGAGGCTCACAGTGC -3'
(R):5'- CCAAATGAAGTTGGGGCAC -3'

Sequencing Primer
(F):5'- ATGAGGCTCACAGTGCATTTTTC -3'
(R):5'- CCAAATGAAGTTGGGGCACTATTAC -3'

Posted On

2014-10-02