Incidental Mutation 'R2199:Xrn2'
ID238542
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name5'-3' exoribonuclease 2
Synonyms
MMRRC Submission 040201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2199 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location147012996-147078000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147024750 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 80 (A80V)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: A80V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: A80V

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147057
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,335,624 I119V probably benign Het
Arfgap2 T A 2: 91,265,692 probably null Het
Ccm2 T C 11: 6,590,790 V216A probably damaging Het
Ctdspl2 T C 2: 121,987,029 probably null Het
Dmxl2 T C 9: 54,376,243 T2769A probably benign Het
Dnah3 C T 7: 119,951,569 V3165M possibly damaging Het
Dnajc1 A C 2: 18,308,899 F137C probably damaging Het
Gli2 A T 1: 118,837,648 D924E possibly damaging Het
Gnrhr T C 5: 86,197,818 N3S probably benign Het
Grhl1 G T 12: 24,612,170 R536L probably damaging Het
Hormad1 T C 3: 95,567,722 probably null Het
Il20 T A 1: 130,910,739 I74L probably benign Het
Ints11 A G 4: 155,875,281 K115R probably benign Het
Irx4 A T 13: 73,265,601 E63D probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kctd8 C A 5: 69,341,245 M19I probably benign Het
Klhl31 T C 9: 77,650,101 L33P probably damaging Het
Lrp1 A T 10: 127,546,840 C3691S probably damaging Het
Lrrc39 A G 3: 116,570,961 D167G probably damaging Het
Lrrd1 A T 5: 3,866,478 I832L possibly damaging Het
Lrriq1 A G 10: 103,068,913 V1620A probably damaging Het
Ltbr T C 6: 125,312,061 K213E probably benign Het
Megf8 T A 7: 25,339,614 D883E possibly damaging Het
Nmt1 T A 11: 103,063,856 S405T probably damaging Het
Nsd3 G T 8: 25,666,057 V547F probably damaging Het
Olfr1215 A G 2: 89,001,550 V246A probably damaging Het
Olfr828 C A 9: 18,815,923 V124F probably damaging Het
Otud7a A G 7: 63,757,656 K569R possibly damaging Het
Otud7b A G 3: 96,155,772 Y776C probably damaging Het
Pcdh15 T C 10: 74,170,509 I73T probably damaging Het
Rnf213 A T 11: 119,460,009 H3890L probably benign Het
Sall3 T C 18: 80,971,870 T948A probably benign Het
Slc44a3 T C 3: 121,513,744 I198V probably benign Het
Slc9a3r2 T C 17: 24,640,596 E174G probably null Het
Smg7 C A 1: 152,854,328 D405Y probably damaging Het
Synpo2l A G 14: 20,661,919 L211S probably benign Het
Thsd7b A G 1: 130,218,158 Y1601C probably benign Het
Traf4 T C 11: 78,159,980 Y450C probably damaging Het
Trpv1 A G 11: 73,240,251 K239E probably damaging Het
Ttn C T 2: 76,754,806 G20302S probably damaging Het
Ube2o A G 11: 116,544,745 S406P probably benign Het
Zfp616 C T 11: 74,084,630 T575I possibly damaging Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6297:Xrn2 UTSW 2 147026570 missense probably damaging 1.00
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6316:Xrn2 UTSW 2 147042010 missense probably damaging 1.00
R6705:Xrn2 UTSW 2 147036662 critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7412:Xrn2 UTSW 2 147049346 missense probably damaging 0.99
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
R7856:Xrn2 UTSW 2 147068473 splice site probably null
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTCCAGTTGATGCCAGTAAACC -3'
(R):5'- ATAATCCATAGCATTGCACAGC -3'

Sequencing Primer
(F):5'- GTTGATGCCAGTAAACCTAATCC -3'
(R):5'- ACAGCAAATGACAAAAGAAAATGTC -3'
Posted On2014-10-02