Incidental Mutation 'R2199:Ltbr'
ID238555
Institutional Source Beutler Lab
Gene Symbol Ltbr
Ensembl Gene ENSMUSG00000030339
Gene Namelymphotoxin B receptor
SynonymsTNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
MMRRC Submission 040201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R2199 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125306571-125313885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125312061 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 213 (K213E)
Ref Sequence ENSEMBL: ENSMUSP00000032489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032489]
Predicted Effect probably benign
Transcript: ENSMUST00000032489
AA Change: K213E

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: K213E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,335,624 I119V probably benign Het
Arfgap2 T A 2: 91,265,692 probably null Het
Ccm2 T C 11: 6,590,790 V216A probably damaging Het
Ctdspl2 T C 2: 121,987,029 probably null Het
Dmxl2 T C 9: 54,376,243 T2769A probably benign Het
Dnah3 C T 7: 119,951,569 V3165M possibly damaging Het
Dnajc1 A C 2: 18,308,899 F137C probably damaging Het
Gli2 A T 1: 118,837,648 D924E possibly damaging Het
Gnrhr T C 5: 86,197,818 N3S probably benign Het
Grhl1 G T 12: 24,612,170 R536L probably damaging Het
Hormad1 T C 3: 95,567,722 probably null Het
Il20 T A 1: 130,910,739 I74L probably benign Het
Ints11 A G 4: 155,875,281 K115R probably benign Het
Irx4 A T 13: 73,265,601 E63D probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kctd8 C A 5: 69,341,245 M19I probably benign Het
Klhl31 T C 9: 77,650,101 L33P probably damaging Het
Lrp1 A T 10: 127,546,840 C3691S probably damaging Het
Lrrc39 A G 3: 116,570,961 D167G probably damaging Het
Lrrd1 A T 5: 3,866,478 I832L possibly damaging Het
Lrriq1 A G 10: 103,068,913 V1620A probably damaging Het
Megf8 T A 7: 25,339,614 D883E possibly damaging Het
Nmt1 T A 11: 103,063,856 S405T probably damaging Het
Nsd3 G T 8: 25,666,057 V547F probably damaging Het
Olfr1215 A G 2: 89,001,550 V246A probably damaging Het
Olfr828 C A 9: 18,815,923 V124F probably damaging Het
Otud7a A G 7: 63,757,656 K569R possibly damaging Het
Otud7b A G 3: 96,155,772 Y776C probably damaging Het
Pcdh15 T C 10: 74,170,509 I73T probably damaging Het
Rnf213 A T 11: 119,460,009 H3890L probably benign Het
Sall3 T C 18: 80,971,870 T948A probably benign Het
Slc44a3 T C 3: 121,513,744 I198V probably benign Het
Slc9a3r2 T C 17: 24,640,596 E174G probably null Het
Smg7 C A 1: 152,854,328 D405Y probably damaging Het
Synpo2l A G 14: 20,661,919 L211S probably benign Het
Thsd7b A G 1: 130,218,158 Y1601C probably benign Het
Traf4 T C 11: 78,159,980 Y450C probably damaging Het
Trpv1 A G 11: 73,240,251 K239E probably damaging Het
Ttn C T 2: 76,754,806 G20302S probably damaging Het
Ube2o A G 11: 116,544,745 S406P probably benign Het
Xrn2 C T 2: 147,024,750 A80V probably damaging Het
Zfp616 C T 11: 74,084,630 T575I possibly damaging Het
Other mutations in Ltbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
bonsai UTSW 6 125312770 missense probably damaging 1.00
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
moksha UTSW 6 125308068 missense probably benign 0.00
Questionable UTSW 6 125313375 splice site probably benign
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5174:Ltbr UTSW 6 125309537 missense probably benign 0.00
R5268:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5361:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5434:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6217:Ltbr UTSW 6 125307454 missense probably damaging 1.00
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
R7101:Ltbr UTSW 6 125312800 missense probably benign 0.00
R7584:Ltbr UTSW 6 125307241 missense probably benign 0.09
R7587:Ltbr UTSW 6 125312352 missense probably benign
R8798:Ltbr UTSW 6 125307295 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGAACTACACGCTACCTCCTTC -3'
(R):5'- TCAACCCCATACCAGGTGAGAG -3'

Sequencing Primer
(F):5'- ACTACACGCTACCTCCTTCTGATTTC -3'
(R):5'- ATACCAGGTGAGAGGGCCC -3'
Posted On2014-10-02