Mutagenetix > Incidental Mutation

Incidental Mutation 'R2199:Olfr828'

238562

Institutional Source

Beutler Lab

Gene Symbol

Olfr828

Ensembl Gene

ENSMUSG00000078116

Gene Name

olfactory receptor 828

Synonyms

MOR149-1, GA_x6K02T2PVTD-12559294-12558356

MMRRC Submission

040201-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R2199 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18814728-18819526 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 18815923 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 124 (V124F)

Ref Sequence

ENSEMBL: ENSMUSP00000148853 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000104914] [ENSMUST00000213018] [ENSMUST00000215380]

AlphaFold

Q8VFM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000104914
AA Change: V124F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000100514
Gene: ENSMUSG00000078116
AA Change: V124F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	310	1e-48	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.4e-5	PFAM
Pfam:7tm_1	41	290	2.1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213018
AA Change: V124F

Predicted Effect

probably damaging
Transcript: ENSMUST00000215380
AA Change: V124F

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,335,624	I119V	probably benign	Het
Arfgap2	T	A	2: 91,265,692		probably null	Het
Ccm2	T	C	11: 6,590,790	V216A	probably damaging	Het
Ctdspl2	T	C	2: 121,987,029		probably null	Het
Dmxl2	T	C	9: 54,376,243	T2769A	probably benign	Het
Dnah3	C	T	7: 119,951,569	V3165M	possibly damaging	Het
Dnajc1	A	C	2: 18,308,899	F137C	probably damaging	Het
Gli2	A	T	1: 118,837,648	D924E	possibly damaging	Het
Gnrhr	T	C	5: 86,197,818	N3S	probably benign	Het
Grhl1	G	T	12: 24,612,170	R536L	probably damaging	Het
Hormad1	T	C	3: 95,567,722		probably null	Het
Il20	T	A	1: 130,910,739	I74L	probably benign	Het
Ints11	A	G	4: 155,875,281	K115R	probably benign	Het
Irx4	A	T	13: 73,265,601	E63D	probably benign	Het
Itch	A	C	2: 155,202,221	Q482P	probably benign	Het
Kctd8	C	A	5: 69,341,245	M19I	probably benign	Het
Klhl31	T	C	9: 77,650,101	L33P	probably damaging	Het
Lrp1	A	T	10: 127,546,840	C3691S	probably damaging	Het
Lrrc39	A	G	3: 116,570,961	D167G	probably damaging	Het
Lrrd1	A	T	5: 3,866,478	I832L	possibly damaging	Het
Lrriq1	A	G	10: 103,068,913	V1620A	probably damaging	Het
Ltbr	T	C	6: 125,312,061	K213E	probably benign	Het
Megf8	T	A	7: 25,339,614	D883E	possibly damaging	Het
Nmt1	T	A	11: 103,063,856	S405T	probably damaging	Het
Nsd3	G	T	8: 25,666,057	V547F	probably damaging	Het
Olfr1215	A	G	2: 89,001,550	V246A	probably damaging	Het
Otud7a	A	G	7: 63,757,656	K569R	possibly damaging	Het
Otud7b	A	G	3: 96,155,772	Y776C	probably damaging	Het
Pcdh15	T	C	10: 74,170,509	I73T	probably damaging	Het
Rnf213	A	T	11: 119,460,009	H3890L	probably benign	Het
Sall3	T	C	18: 80,971,870	T948A	probably benign	Het
Slc44a3	T	C	3: 121,513,744	I198V	probably benign	Het
Slc9a3r2	T	C	17: 24,640,596	E174G	probably null	Het
Smg7	C	A	1: 152,854,328	D405Y	probably damaging	Het
Synpo2l	A	G	14: 20,661,919	L211S	probably benign	Het
Thsd7b	A	G	1: 130,218,158	Y1601C	probably benign	Het
Traf4	T	C	11: 78,159,980	Y450C	probably damaging	Het
Trpv1	A	G	11: 73,240,251	K239E	probably damaging	Het
Ttn	C	T	2: 76,754,806	G20302S	probably damaging	Het
Ube2o	A	G	11: 116,544,745	S406P	probably benign	Het
Xrn2	C	T	2: 147,024,750	A80V	probably damaging	Het
Zfp616	C	T	11: 74,084,630	T575I	possibly damaging	Het

Other mutations in Olfr828

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Olfr828	APN	9	18815923	missense	probably benign	0.03
IGL02103:Olfr828	APN	9	18815709	missense	probably damaging	1.00
IGL02792:Olfr828	APN	9	18815958	missense	probably benign	0.00
IGL02964:Olfr828	APN	9	18815728	missense	probably damaging	1.00
IGL03087:Olfr828	APN	9	18816084	missense	probably damaging	1.00
IGL03105:Olfr828	APN	9	18815389	missense	probably benign	0.03
R0330:Olfr828	UTSW	9	18815641	missense	probably damaging	1.00
R0335:Olfr828	UTSW	9	18815994	missense	probably damaging	1.00
R0862:Olfr828	UTSW	9	18815706	missense	probably damaging	0.98
R1226:Olfr828	UTSW	9	18815970	missense	probably benign	0.34
R2004:Olfr828	UTSW	9	18815505	missense	probably benign	0.05
R2005:Olfr828	UTSW	9	18815505	missense	probably benign	0.05
R2006:Olfr828	UTSW	9	18815505	missense	probably benign	0.05
R2230:Olfr828	UTSW	9	18815725	missense	probably damaging	1.00
R2399:Olfr828	UTSW	9	18816027	missense	probably benign	0.07
R5652:Olfr828	UTSW	9	18815626	missense	probably damaging	1.00
R5738:Olfr828	UTSW	9	18815829	missense	possibly damaging	0.81
R6416:Olfr828	UTSW	9	18815892	missense	probably benign	0.21
R6813:Olfr828	UTSW	9	18815892	missense	probably benign	0.21
R7092:Olfr828	UTSW	9	18816057	missense	probably damaging	1.00
R7109:Olfr828	UTSW	9	18815608	missense	probably benign	0.01
R7292:Olfr828	UTSW	9	18816190	missense	probably damaging	1.00
R7429:Olfr828	UTSW	9	18815354	makesense	probably null
R7430:Olfr828	UTSW	9	18815354	makesense	probably null
R7490:Olfr828	UTSW	9	18815933	nonsense	probably null
R7835:Olfr828	UTSW	9	18815809	missense	probably benign	0.05
R8016:Olfr828	UTSW	9	18816292	start codon destroyed	probably null	0.56
R8809:Olfr828	UTSW	9	18815623	missense	probably damaging	0.99
R8859:Olfr828	UTSW	9	18815696	missense	possibly damaging	0.90
R9036:Olfr828	UTSW	9	18816273	missense	probably damaging	1.00
R9079:Olfr828	UTSW	9	18815435	missense	probably damaging	0.99
R9177:Olfr828	UTSW	9	18815446	missense	probably damaging	1.00
R9182:Olfr828	UTSW	9	18815446	missense	probably damaging	1.00
R9184:Olfr828	UTSW	9	18815842	missense	probably benign	0.10
RF003:Olfr828	UTSW	9	18815482	missense	probably benign	0.03
X0026:Olfr828	UTSW	9	18815763	missense	possibly damaging	0.95
Z1176:Olfr828	UTSW	9	18815980	frame shift	probably null
Z1177:Olfr828	UTSW	9	18816148	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GCTAGCTTGATGACTTGAGCAAG -3'
(R):5'- TCACCATCTTGGGAAATCTGC -3'

Sequencing Primer
(F):5'- GTTCACAGAAAAATAGGGGGATTTC -3'
(R):5'- GGGAAATCTGCTCATCATTCTAACTG -3'

Posted On

2014-10-02