Incidental Mutation 'R2199:Irx4'
ID238576
Institutional Source Beutler Lab
Gene Symbol Irx4
Ensembl Gene ENSMUSG00000021604
Gene NameIroquois homeobox 4
Synonyms
MMRRC Submission 040201-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R2199 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location73260479-73269608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73265601 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 63 (E63D)
Ref Sequence ENSEMBL: ENSMUSP00000134738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022095] [ENSMUST00000176684]
Predicted Effect probably benign
Transcript: ENSMUST00000022095
AA Change: E63D

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022095
Gene: ENSMUSG00000021604
AA Change: E63D

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
HOX 143 208 5.33e-13 SMART
low complexity region 223 238 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
IRO 362 379 6.36e-4 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176684
AA Change: E63D

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134738
Gene: ENSMUSG00000021604
AA Change: E63D

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
HOX 143 208 5.33e-13 SMART
low complexity region 223 238 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
IRO 362 379 6.36e-4 SMART
low complexity region 399 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal ventricular gene expression followed by cardiomyopathy with hypertrophy and impaired contractile function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,335,624 I119V probably benign Het
Arfgap2 T A 2: 91,265,692 probably null Het
Ccm2 T C 11: 6,590,790 V216A probably damaging Het
Ctdspl2 T C 2: 121,987,029 probably null Het
Dmxl2 T C 9: 54,376,243 T2769A probably benign Het
Dnah3 C T 7: 119,951,569 V3165M possibly damaging Het
Dnajc1 A C 2: 18,308,899 F137C probably damaging Het
Gli2 A T 1: 118,837,648 D924E possibly damaging Het
Gnrhr T C 5: 86,197,818 N3S probably benign Het
Grhl1 G T 12: 24,612,170 R536L probably damaging Het
Hormad1 T C 3: 95,567,722 probably null Het
Il20 T A 1: 130,910,739 I74L probably benign Het
Ints11 A G 4: 155,875,281 K115R probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kctd8 C A 5: 69,341,245 M19I probably benign Het
Klhl31 T C 9: 77,650,101 L33P probably damaging Het
Lrp1 A T 10: 127,546,840 C3691S probably damaging Het
Lrrc39 A G 3: 116,570,961 D167G probably damaging Het
Lrrd1 A T 5: 3,866,478 I832L possibly damaging Het
Lrriq1 A G 10: 103,068,913 V1620A probably damaging Het
Ltbr T C 6: 125,312,061 K213E probably benign Het
Megf8 T A 7: 25,339,614 D883E possibly damaging Het
Nmt1 T A 11: 103,063,856 S405T probably damaging Het
Nsd3 G T 8: 25,666,057 V547F probably damaging Het
Olfr1215 A G 2: 89,001,550 V246A probably damaging Het
Olfr828 C A 9: 18,815,923 V124F probably damaging Het
Otud7a A G 7: 63,757,656 K569R possibly damaging Het
Otud7b A G 3: 96,155,772 Y776C probably damaging Het
Pcdh15 T C 10: 74,170,509 I73T probably damaging Het
Rnf213 A T 11: 119,460,009 H3890L probably benign Het
Sall3 T C 18: 80,971,870 T948A probably benign Het
Slc44a3 T C 3: 121,513,744 I198V probably benign Het
Slc9a3r2 T C 17: 24,640,596 E174G probably null Het
Smg7 C A 1: 152,854,328 D405Y probably damaging Het
Synpo2l A G 14: 20,661,919 L211S probably benign Het
Thsd7b A G 1: 130,218,158 Y1601C probably benign Het
Traf4 T C 11: 78,159,980 Y450C probably damaging Het
Trpv1 A G 11: 73,240,251 K239E probably damaging Het
Ttn C T 2: 76,754,806 G20302S probably damaging Het
Ube2o A G 11: 116,544,745 S406P probably benign Het
Xrn2 C T 2: 147,024,750 A80V probably damaging Het
Zfp616 C T 11: 74,084,630 T575I possibly damaging Het
Other mutations in Irx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Irx4 APN 13 73268691 missense probably benign
IGL00979:Irx4 APN 13 73268222 splice site probably benign
IGL01291:Irx4 APN 13 73267667 missense probably damaging 1.00
IGL02054:Irx4 APN 13 73268828 missense probably damaging 1.00
IGL02631:Irx4 APN 13 73268477 missense probably damaging 1.00
IGL02893:Irx4 APN 13 73268778 missense probably damaging 1.00
IGL03310:Irx4 APN 13 73267731 missense possibly damaging 0.47
ANU05:Irx4 UTSW 13 73267667 missense probably damaging 1.00
R0468:Irx4 UTSW 13 73266720 splice site probably benign
R0502:Irx4 UTSW 13 73266584 splice site probably null
R0503:Irx4 UTSW 13 73266584 splice site probably null
R1468:Irx4 UTSW 13 73265576 missense possibly damaging 0.53
R1468:Irx4 UTSW 13 73265576 missense possibly damaging 0.53
R1710:Irx4 UTSW 13 73267638 missense possibly damaging 0.90
R1733:Irx4 UTSW 13 73266705 missense probably benign 0.00
R2076:Irx4 UTSW 13 73268265 missense probably damaging 1.00
R2092:Irx4 UTSW 13 73265486 missense probably damaging 0.97
R2127:Irx4 UTSW 13 73265476 missense probably benign 0.03
R4157:Irx4 UTSW 13 73265543 missense probably benign 0.00
R4883:Irx4 UTSW 13 73267631 missense probably damaging 1.00
R4930:Irx4 UTSW 13 73268913 missense probably benign 0.00
R4990:Irx4 UTSW 13 73265507 missense probably benign 0.28
R4991:Irx4 UTSW 13 73265507 missense probably benign 0.28
R5119:Irx4 UTSW 13 73268921 missense probably benign
R5399:Irx4 UTSW 13 73265539 missense probably benign 0.01
R5596:Irx4 UTSW 13 73267680 missense probably damaging 1.00
R5956:Irx4 UTSW 13 73267507 nonsense probably null
R6271:Irx4 UTSW 13 73266594 critical splice acceptor site probably null
R6383:Irx4 UTSW 13 73267713 missense possibly damaging 0.92
R6630:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6631:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6632:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6633:Irx4 UTSW 13 73268426 missense probably benign 0.00
R7378:Irx4 UTSW 13 73267553 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGACACGTGAGGTCCTTGAG -3'
(R):5'- CTTAGCAAACTCAAGGTACGGGG -3'

Sequencing Primer
(F):5'- AGGTCCTTGAGGGTCCAG -3'
(R):5'- CAAGGTACGGGGCGGGG -3'
Posted On2014-10-02