Incidental Mutation 'R2200:Ptpru'
ID 238601
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Name protein tyrosine phosphatase receptor type U
Synonyms RPTPlambda, Ptprl
MMRRC Submission 040202-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2200 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 131495768-131565599 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 131548124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 52 (N52K)
Ref Sequence ENSEMBL: ENSMUSP00000095472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
AlphaFold B1AUH1
Predicted Effect possibly damaging
Transcript: ENSMUST00000030741
AA Change: N124K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: N124K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097860
AA Change: N52K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: N52K

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000105987
AA Change: N124K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: N124K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 57,265,423 (GRCm39) I135M probably benign Het
Ano7 A G 1: 93,308,158 (GRCm39) E63G possibly damaging Het
Asah1 A G 8: 41,796,765 (GRCm39) probably null Het
B3gat2 C T 1: 23,801,873 (GRCm39) P53L probably benign Het
Bmp8b A T 4: 123,016,815 (GRCm39) M339L possibly damaging Het
Bpifb9b C A 2: 154,155,574 (GRCm39) Q358K probably benign Het
Cbs T C 17: 31,843,238 (GRCm39) D231G probably damaging Het
Chd6 A G 2: 160,825,673 (GRCm39) Y1144H probably damaging Het
Clca3a2 T A 3: 144,519,685 (GRCm39) I230L probably benign Het
Clec2d A T 6: 129,161,831 (GRCm39) T155S possibly damaging Het
Cpxm1 G T 2: 130,235,117 (GRCm39) F567L probably damaging Het
Cyp4f16 G T 17: 32,756,078 (GRCm39) A36S probably damaging Het
Dnah17 T C 11: 117,993,235 (GRCm39) probably benign Het
Eml5 T C 12: 98,791,676 (GRCm39) D1280G probably damaging Het
Ergic1 C A 17: 26,860,566 (GRCm39) A218D possibly damaging Het
Eva1a A G 6: 82,068,894 (GRCm39) R74G probably benign Het
Fhip1a A G 3: 85,637,628 (GRCm39) S224P probably damaging Het
Fus T A 7: 127,576,400 (GRCm39) N273K probably damaging Het
Ipo13 A C 4: 117,762,100 (GRCm39) probably null Het
Itgb3 T A 11: 104,531,812 (GRCm39) probably null Het
Lrif1 T A 3: 106,641,874 (GRCm39) S63R probably damaging Het
Lrig3 A G 10: 125,832,478 (GRCm39) probably null Het
Lrp1b A T 2: 41,174,177 (GRCm39) N1547K probably benign Het
Mme A T 3: 63,287,713 (GRCm39) N738I possibly damaging Het
Morc2a A G 11: 3,633,919 (GRCm39) N677S probably benign Het
Mrpl35 A C 6: 71,794,723 (GRCm39) L82V probably benign Het
Mybpc1 A T 10: 88,391,557 (GRCm39) N313K probably damaging Het
Podn T C 4: 107,879,787 (GRCm39) D66G probably damaging Het
Pyroxd1 G T 6: 142,304,808 (GRCm39) R345L probably benign Het
Qser1 A G 2: 104,619,358 (GRCm39) S485P probably damaging Het
Rbm46 A T 3: 82,771,351 (GRCm39) D421E probably benign Het
Rgs10 T C 7: 127,990,761 (GRCm39) E109G probably damaging Het
Samd8 C T 14: 21,825,388 (GRCm39) P178S probably benign Het
Scaf11 T C 15: 96,318,404 (GRCm39) K387E probably damaging Het
Sccpdh G T 1: 179,498,171 (GRCm39) V72F possibly damaging Het
Sec22a A T 16: 35,134,527 (GRCm39) V285E probably damaging Het
Slc19a3 A G 1: 83,000,664 (GRCm39) S118P probably damaging Het
Sun1 C A 5: 139,216,974 (GRCm39) R338S probably benign Het
Taf1c A G 8: 120,325,417 (GRCm39) F815S probably benign Het
Zcchc14 A T 8: 122,332,167 (GRCm39) probably benign Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131,535,546 (GRCm39) missense probably benign 0.00
IGL00966:Ptpru APN 4 131,499,927 (GRCm39) missense probably damaging 1.00
IGL01451:Ptpru APN 4 131,496,803 (GRCm39) utr 3 prime probably benign
IGL01453:Ptpru APN 4 131,496,803 (GRCm39) utr 3 prime probably benign
IGL01606:Ptpru APN 4 131,535,792 (GRCm39) missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131,504,086 (GRCm39) splice site probably benign
IGL03135:Ptpru APN 4 131,546,111 (GRCm39) missense probably damaging 0.97
IGL03366:Ptpru APN 4 131,507,178 (GRCm39) missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131,527,023 (GRCm39) missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131,529,855 (GRCm39) nonsense probably null
R0299:Ptpru UTSW 4 131,530,698 (GRCm39) nonsense probably null
R0458:Ptpru UTSW 4 131,526,986 (GRCm39) missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131,520,954 (GRCm39) missense probably benign 0.02
R0503:Ptpru UTSW 4 131,520,954 (GRCm39) missense probably benign 0.02
R0619:Ptpru UTSW 4 131,548,198 (GRCm39) missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131,498,490 (GRCm39) missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131,525,259 (GRCm39) missense probably benign 0.10
R1065:Ptpru UTSW 4 131,535,651 (GRCm39) missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131,535,838 (GRCm39) splice site probably benign
R1382:Ptpru UTSW 4 131,535,540 (GRCm39) missense probably damaging 0.98
R1442:Ptpru UTSW 4 131,535,580 (GRCm39) missense probably benign 0.00
R1538:Ptpru UTSW 4 131,501,662 (GRCm39) missense probably damaging 0.99
R1624:Ptpru UTSW 4 131,499,861 (GRCm39) missense probably damaging 1.00
R1688:Ptpru UTSW 4 131,514,656 (GRCm39) missense probably benign 0.01
R1699:Ptpru UTSW 4 131,506,361 (GRCm39) missense probably damaging 1.00
R1740:Ptpru UTSW 4 131,520,989 (GRCm39) splice site probably null
R1874:Ptpru UTSW 4 131,497,066 (GRCm39) missense probably benign
R1959:Ptpru UTSW 4 131,530,788 (GRCm39) missense probably damaging 1.00
R2051:Ptpru UTSW 4 131,546,398 (GRCm39) missense possibly damaging 0.80
R2281:Ptpru UTSW 4 131,535,810 (GRCm39) missense probably damaging 1.00
R2304:Ptpru UTSW 4 131,499,879 (GRCm39) missense probably damaging 1.00
R2411:Ptpru UTSW 4 131,498,780 (GRCm39) missense probably damaging 1.00
R2845:Ptpru UTSW 4 131,546,972 (GRCm39) missense probably benign 0.00
R3767:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3768:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3769:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3770:Ptpru UTSW 4 131,535,735 (GRCm39) missense probably damaging 1.00
R3937:Ptpru UTSW 4 131,501,615 (GRCm39) missense probably damaging 0.99
R4079:Ptpru UTSW 4 131,526,021 (GRCm39) critical splice donor site probably null
R4110:Ptpru UTSW 4 131,546,348 (GRCm39) missense probably damaging 1.00
R4170:Ptpru UTSW 4 131,503,659 (GRCm39) missense probably damaging 1.00
R4716:Ptpru UTSW 4 131,548,279 (GRCm39) missense probably benign
R4751:Ptpru UTSW 4 131,529,897 (GRCm39) missense probably damaging 0.97
R4766:Ptpru UTSW 4 131,548,275 (GRCm39) missense probably damaging 1.00
R4825:Ptpru UTSW 4 131,526,914 (GRCm39) missense probably benign
R4900:Ptpru UTSW 4 131,515,693 (GRCm39) missense probably damaging 0.99
R4998:Ptpru UTSW 4 131,504,196 (GRCm39) missense probably damaging 1.00
R5279:Ptpru UTSW 4 131,547,334 (GRCm39) missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131,499,868 (GRCm39) missense probably damaging 1.00
R5625:Ptpru UTSW 4 131,530,691 (GRCm39) missense probably null 1.00
R5667:Ptpru UTSW 4 131,547,501 (GRCm39) missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131,547,501 (GRCm39) missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131,565,401 (GRCm39) missense probably benign 0.01
R5802:Ptpru UTSW 4 131,515,688 (GRCm39) missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131,513,067 (GRCm39) missense probably benign 0.34
R5953:Ptpru UTSW 4 131,504,148 (GRCm39) missense probably damaging 1.00
R5973:Ptpru UTSW 4 131,546,236 (GRCm39) missense probably benign 0.00
R6029:Ptpru UTSW 4 131,498,604 (GRCm39) missense probably damaging 1.00
R6072:Ptpru UTSW 4 131,503,539 (GRCm39) missense probably damaging 0.99
R6089:Ptpru UTSW 4 131,499,941 (GRCm39) missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131,513,065 (GRCm39) missense probably benign
R6177:Ptpru UTSW 4 131,520,836 (GRCm39) missense probably benign 0.00
R6367:Ptpru UTSW 4 131,501,663 (GRCm39) missense probably benign 0.18
R6682:Ptpru UTSW 4 131,548,093 (GRCm39) missense probably benign
R6950:Ptpru UTSW 4 131,503,663 (GRCm39) missense probably damaging 0.99
R7159:Ptpru UTSW 4 131,546,851 (GRCm39) missense probably damaging 1.00
R7736:Ptpru UTSW 4 131,515,693 (GRCm39) missense probably damaging 1.00
R7960:Ptpru UTSW 4 131,515,820 (GRCm39) missense probably benign 0.01
R8094:Ptpru UTSW 4 131,520,903 (GRCm39) missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131,522,274 (GRCm39) nonsense probably null
R8276:Ptpru UTSW 4 131,506,484 (GRCm39) missense probably damaging 1.00
R8355:Ptpru UTSW 4 131,535,811 (GRCm39) missense probably damaging 1.00
R8377:Ptpru UTSW 4 131,535,646 (GRCm39) missense probably damaging 1.00
R8416:Ptpru UTSW 4 131,535,783 (GRCm39) missense probably damaging 1.00
R8858:Ptpru UTSW 4 131,526,825 (GRCm39) splice site probably benign
R8911:Ptpru UTSW 4 131,503,560 (GRCm39) missense probably damaging 0.96
R8934:Ptpru UTSW 4 131,546,297 (GRCm39) missense probably damaging 0.98
R9031:Ptpru UTSW 4 131,515,691 (GRCm39) missense probably damaging 1.00
R9069:Ptpru UTSW 4 131,503,565 (GRCm39) missense possibly damaging 0.87
R9096:Ptpru UTSW 4 131,499,843 (GRCm39) missense probably damaging 1.00
R9097:Ptpru UTSW 4 131,499,843 (GRCm39) missense probably damaging 1.00
R9151:Ptpru UTSW 4 131,522,278 (GRCm39) missense probably benign
R9166:Ptpru UTSW 4 131,525,180 (GRCm39) missense probably benign 0.00
R9174:Ptpru UTSW 4 131,535,746 (GRCm39) missense probably damaging 1.00
R9242:Ptpru UTSW 4 131,530,341 (GRCm39) missense probably damaging 1.00
R9698:Ptpru UTSW 4 131,547,531 (GRCm39) missense probably benign 0.09
X0024:Ptpru UTSW 4 131,498,501 (GRCm39) missense probably benign 0.15
Z1177:Ptpru UTSW 4 131,535,573 (GRCm39) missense probably damaging 0.99
Z1177:Ptpru UTSW 4 131,527,017 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCGAACTCCAAACTC -3'
(R):5'- TCTGCAGGTGCCTACTTGATG -3'

Sequencing Primer
(F):5'- TGACTCCTGATGCTGAACAG -3'
(R):5'- ACTTGATGGTCAATGCTTCTCAG -3'
Posted On 2014-10-02