Incidental Mutation 'R2200:Rgs10'
ID238609
Institutional Source Beutler Lab
Gene Symbol Rgs10
Ensembl Gene ENSMUSG00000030844
Gene Nameregulator of G-protein signalling 10
Synonyms
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R2200 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128373621-128418758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128389037 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 109 (E109G)
Ref Sequence ENSEMBL: ENSMUSP00000033133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033133]
Predicted Effect probably damaging
Transcript: ENSMUST00000033133
AA Change: E109G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033133
Gene: ENSMUSG00000030844
AA Change: E109G

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
RGS 41 156 7.05e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134144
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 10 belongs to this family. All RGS proteins share a conserved 120-amino acid sequence termed the RGS domain. This protein associates specifically with the activated forms of the two related G-protein subunits, G-alphai3 and G-alphaz but fails to interact with the structurally and functionally distinct G-alpha subunits. Regulator of G protein signaling 10 protein is localized in the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap mutation of this gene results in impaired glucose tolerance and increased fasting glucose levels whereas a targeted knockout shows defects in osteoclast differentiation and in the skeleton. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Bpifb9b C A 2: 154,313,654 Q358K probably benign Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Cyp4f16 G T 17: 32,537,104 A36S probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Morc2a A G 11: 3,683,919 N677S probably benign Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Podn T C 4: 108,022,590 D66G probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Qser1 A G 2: 104,789,013 S485P probably damaging Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Sun1 C A 5: 139,231,219 R338S probably benign Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Rgs10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1682:Rgs10 UTSW 7 128373970 missense probably benign
R1714:Rgs10 UTSW 7 128403222 missense probably damaging 0.98
R1801:Rgs10 UTSW 7 128404477 missense possibly damaging 0.67
R3118:Rgs10 UTSW 7 128403231 missense probably damaging 1.00
R3119:Rgs10 UTSW 7 128403231 missense probably damaging 1.00
R6903:Rgs10 UTSW 7 128389073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCTGGGGAATGTAGCAG -3'
(R):5'- CAGAAGCTCTATTAGGTGTGGG -3'

Sequencing Primer
(F):5'- TGTAGCAGCTCCCTGAAGAATTC -3'
(R):5'- GCCTTCTCAGGGAGCTTG -3'
Posted On2014-10-02