Incidental Mutation 'R0180:Mroh1'
ID23861
Institutional Source Beutler Lab
Gene Symbol Mroh1
Ensembl Gene ENSMUSG00000022558
Gene Namemaestro heat-like repeat family member 1
SynonymsHeatr7a, D330001F17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome15
Chromosomal Location76380261-76453038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76428250 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 546 (S546T)
Ref Sequence ENSEMBL: ENSMUSP00000094115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092595] [ENSMUST00000096385] [ENSMUST00000159218] [ENSMUST00000160631] [ENSMUST00000161305]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092595
AA Change: S546T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090256
Gene: ENSMUSG00000022558
AA Change: S546T

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 435 4e-10 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096385
AA Change: S546T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558
AA Change: S546T

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159218
AA Change: S546T

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124811
Gene: ENSMUSG00000022558
AA Change: S546T

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1346 1358 N/A INTRINSIC
low complexity region 1479 1493 N/A INTRINSIC
Pfam:HEAT 1601 1631 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160631
SMART Domains Protein: ENSMUSP00000123806
Gene: ENSMUSG00000022558

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect possibly damaging
Transcript: ENSMUST00000161305
AA Change: S546T

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183412
Meta Mutation Damage Score 0.2170 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Mroh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Mroh1 APN 15 76432288 missense probably benign 0.01
IGL02141:Mroh1 APN 15 76446599 missense possibly damaging 0.47
IGL02146:Mroh1 APN 15 76434679 splice site probably benign
IGL02205:Mroh1 APN 15 76437239 missense possibly damaging 0.81
IGL02261:Mroh1 APN 15 76429160 missense probably benign 0.03
IGL02818:Mroh1 APN 15 76432401 splice site probably null
IGL02949:Mroh1 APN 15 76408968 missense probably damaging 0.97
IGL02951:Mroh1 APN 15 76427636 missense probably damaging 1.00
IGL03154:Mroh1 APN 15 76452838 missense probably damaging 1.00
IGL02799:Mroh1 UTSW 15 76392461 critical splice donor site probably null
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0076:Mroh1 UTSW 15 76451140 missense probably benign 0.00
R0315:Mroh1 UTSW 15 76427600 missense possibly damaging 0.94
R0350:Mroh1 UTSW 15 76432249 missense probably damaging 0.98
R0399:Mroh1 UTSW 15 76452099 missense probably benign 0.44
R0835:Mroh1 UTSW 15 76451883 missense probably damaging 0.96
R0893:Mroh1 UTSW 15 76408938 missense possibly damaging 0.62
R1109:Mroh1 UTSW 15 76446509 splice site probably benign
R1527:Mroh1 UTSW 15 76452263 missense probably benign 0.03
R1595:Mroh1 UTSW 15 76433530 splice site probably benign
R1900:Mroh1 UTSW 15 76433385 missense probably benign 0.00
R1901:Mroh1 UTSW 15 76436049 missense probably benign
R2223:Mroh1 UTSW 15 76408045 critical splice donor site probably null
R2415:Mroh1 UTSW 15 76421211 missense probably damaging 0.99
R3113:Mroh1 UTSW 15 76408536 splice site probably benign
R3437:Mroh1 UTSW 15 76433608 missense possibly damaging 0.92
R3618:Mroh1 UTSW 15 76452346 missense possibly damaging 0.55
R3833:Mroh1 UTSW 15 76401619 missense probably benign 0.08
R4073:Mroh1 UTSW 15 76407985 missense probably benign 0.13
R4156:Mroh1 UTSW 15 76402126 splice site probably null
R4276:Mroh1 UTSW 15 76393851 missense probably damaging 1.00
R4745:Mroh1 UTSW 15 76408530 critical splice donor site probably null
R5450:Mroh1 UTSW 15 76432347 intron probably benign
R5574:Mroh1 UTSW 15 76433931 missense probably benign
R5673:Mroh1 UTSW 15 76430181 missense probably damaging 1.00
R5970:Mroh1 UTSW 15 76451491 missense probably benign 0.24
R5993:Mroh1 UTSW 15 76446680 missense probably damaging 0.99
R6008:Mroh1 UTSW 15 76451357 missense possibly damaging 0.50
R6082:Mroh1 UTSW 15 76430223 missense probably benign 0.06
R6302:Mroh1 UTSW 15 76436119 critical splice donor site probably null
R7030:Mroh1 UTSW 15 76437317 missense probably benign 0.01
R7098:Mroh1 UTSW 15 76408457 nonsense probably null
R7334:Mroh1 UTSW 15 76427638 missense probably benign 0.00
R7337:Mroh1 UTSW 15 76451476 missense probably benign 0.00
R7352:Mroh1 UTSW 15 76451474 missense probably benign 0.06
R7446:Mroh1 UTSW 15 76452272 missense possibly damaging 0.93
R7453:Mroh1 UTSW 15 76433545 missense probably damaging 1.00
R7669:Mroh1 UTSW 15 76451848 missense possibly damaging 0.88
R7753:Mroh1 UTSW 15 76433275 missense possibly damaging 0.62
R7860:Mroh1 UTSW 15 76447332 missense probably benign 0.00
R7943:Mroh1 UTSW 15 76447332 missense probably benign 0.00
Z1177:Mroh1 UTSW 15 76423761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGACCGAGCTTACTCTGATAG -3'
(R):5'- GTTTCTTTCAACCCGAACGGCATAC -3'

Sequencing Primer
(F):5'- ACTCTGATAGAAGAGTGGCCTCTC -3'
(R):5'- CGAACGGCATACTGGGTG -3'
Posted On2013-04-16