Incidental Mutation 'R2200:Mybpc1'
ID 238613
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Name myosin binding protein C, slow-type
Synonyms Slow-type C-protein, 8030451F13Rik
MMRRC Submission 040202-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.862) question?
Stock # R2200 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88354141-88441014 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 88391557 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 313 (N313K)
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
AlphaFold A0A571BEN1
Predicted Effect probably damaging
Transcript: ENSMUST00000119185
AA Change: N299K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: N299K

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121629
AA Change: N313K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: N313K

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156573
SMART Domains Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
PDB:1X44|A 2 58 1e-26 PDB
IG 66 146 6.97e-3 SMART
IG 159 244 2.83e-3 SMART
FN3 247 330 4.28e-10 SMART
FN3 345 446 1.6e-9 SMART
low complexity region 458 470 N/A INTRINSIC
IG 473 556 9.06e-2 SMART
FN3 559 617 8.17e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 57,265,423 (GRCm39) I135M probably benign Het
Ano7 A G 1: 93,308,158 (GRCm39) E63G possibly damaging Het
Asah1 A G 8: 41,796,765 (GRCm39) probably null Het
B3gat2 C T 1: 23,801,873 (GRCm39) P53L probably benign Het
Bmp8b A T 4: 123,016,815 (GRCm39) M339L possibly damaging Het
Bpifb9b C A 2: 154,155,574 (GRCm39) Q358K probably benign Het
Cbs T C 17: 31,843,238 (GRCm39) D231G probably damaging Het
Chd6 A G 2: 160,825,673 (GRCm39) Y1144H probably damaging Het
Clca3a2 T A 3: 144,519,685 (GRCm39) I230L probably benign Het
Clec2d A T 6: 129,161,831 (GRCm39) T155S possibly damaging Het
Cpxm1 G T 2: 130,235,117 (GRCm39) F567L probably damaging Het
Cyp4f16 G T 17: 32,756,078 (GRCm39) A36S probably damaging Het
Dnah17 T C 11: 117,993,235 (GRCm39) probably benign Het
Eml5 T C 12: 98,791,676 (GRCm39) D1280G probably damaging Het
Ergic1 C A 17: 26,860,566 (GRCm39) A218D possibly damaging Het
Eva1a A G 6: 82,068,894 (GRCm39) R74G probably benign Het
Fhip1a A G 3: 85,637,628 (GRCm39) S224P probably damaging Het
Fus T A 7: 127,576,400 (GRCm39) N273K probably damaging Het
Ipo13 A C 4: 117,762,100 (GRCm39) probably null Het
Itgb3 T A 11: 104,531,812 (GRCm39) probably null Het
Lrif1 T A 3: 106,641,874 (GRCm39) S63R probably damaging Het
Lrig3 A G 10: 125,832,478 (GRCm39) probably null Het
Lrp1b A T 2: 41,174,177 (GRCm39) N1547K probably benign Het
Mme A T 3: 63,287,713 (GRCm39) N738I possibly damaging Het
Morc2a A G 11: 3,633,919 (GRCm39) N677S probably benign Het
Mrpl35 A C 6: 71,794,723 (GRCm39) L82V probably benign Het
Podn T C 4: 107,879,787 (GRCm39) D66G probably damaging Het
Ptpru A T 4: 131,548,124 (GRCm39) N52K probably damaging Het
Pyroxd1 G T 6: 142,304,808 (GRCm39) R345L probably benign Het
Qser1 A G 2: 104,619,358 (GRCm39) S485P probably damaging Het
Rbm46 A T 3: 82,771,351 (GRCm39) D421E probably benign Het
Rgs10 T C 7: 127,990,761 (GRCm39) E109G probably damaging Het
Samd8 C T 14: 21,825,388 (GRCm39) P178S probably benign Het
Scaf11 T C 15: 96,318,404 (GRCm39) K387E probably damaging Het
Sccpdh G T 1: 179,498,171 (GRCm39) V72F possibly damaging Het
Sec22a A T 16: 35,134,527 (GRCm39) V285E probably damaging Het
Slc19a3 A G 1: 83,000,664 (GRCm39) S118P probably damaging Het
Sun1 C A 5: 139,216,974 (GRCm39) R338S probably benign Het
Taf1c A G 8: 120,325,417 (GRCm39) F815S probably benign Het
Zcchc14 A T 8: 122,332,167 (GRCm39) probably benign Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88,385,124 (GRCm39) missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88,372,246 (GRCm39) missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88,360,970 (GRCm39) splice site probably null
IGL00964:Mybpc1 APN 10 88,391,604 (GRCm39) critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88,406,507 (GRCm39) missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88,367,632 (GRCm39) missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88,372,290 (GRCm39) missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88,362,235 (GRCm39) missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88,391,600 (GRCm39) missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88,376,822 (GRCm39) missense probably damaging 1.00
R0879:Mybpc1 UTSW 10 88,407,378 (GRCm39) splice site probably benign
R1321:Mybpc1 UTSW 10 88,406,463 (GRCm39) missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88,365,403 (GRCm39) missense possibly damaging 0.85
R1562:Mybpc1 UTSW 10 88,389,193 (GRCm39) missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88,389,157 (GRCm39) missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88,384,688 (GRCm39) missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88,387,404 (GRCm39) missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88,381,921 (GRCm39) missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88,409,299 (GRCm39) nonsense probably null
R2129:Mybpc1 UTSW 10 88,387,314 (GRCm39) missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88,376,804 (GRCm39) splice site probably benign
R2219:Mybpc1 UTSW 10 88,391,540 (GRCm39) missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88,387,269 (GRCm39) missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88,367,641 (GRCm39) missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88,406,521 (GRCm39) splice site probably null
R4032:Mybpc1 UTSW 10 88,365,426 (GRCm39) missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88,409,387 (GRCm39) nonsense probably null
R4821:Mybpc1 UTSW 10 88,384,727 (GRCm39) missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R4876:Mybpc1 UTSW 10 88,358,853 (GRCm39) missense probably benign
R4878:Mybpc1 UTSW 10 88,387,292 (GRCm39) missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88,391,586 (GRCm39) nonsense probably null
R4913:Mybpc1 UTSW 10 88,389,116 (GRCm39) critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88,391,525 (GRCm39) missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88,379,636 (GRCm39) missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88,381,926 (GRCm39) missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88,372,213 (GRCm39) missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88,406,430 (GRCm39) missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88,358,876 (GRCm39) missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88,381,891 (GRCm39) missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88,406,428 (GRCm39) missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88,378,318 (GRCm39) missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88,404,481 (GRCm39) missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88,396,217 (GRCm39) missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88,389,139 (GRCm39) missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88,358,861 (GRCm39) missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88,372,243 (GRCm39) missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88,378,192 (GRCm39) nonsense probably null
R6972:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88,396,223 (GRCm39) missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88,358,886 (GRCm39) missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88,389,274 (GRCm39) missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88,379,581 (GRCm39) missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88,385,209 (GRCm39) missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88,362,155 (GRCm39) missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88,385,187 (GRCm39) missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88,384,716 (GRCm39) missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88,378,234 (GRCm39) missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88,394,529 (GRCm39) missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88,358,865 (GRCm39) missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88,394,553 (GRCm39) missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88,372,286 (GRCm39) missense probably benign 0.03
R8360:Mybpc1 UTSW 10 88,409,359 (GRCm39) nonsense probably null
R8494:Mybpc1 UTSW 10 88,362,291 (GRCm39) missense probably benign 0.01
R8849:Mybpc1 UTSW 10 88,407,447 (GRCm39) missense probably benign 0.01
R8936:Mybpc1 UTSW 10 88,394,437 (GRCm39) missense probably benign 0.44
R9031:Mybpc1 UTSW 10 88,358,906 (GRCm39) missense probably damaging 0.99
R9061:Mybpc1 UTSW 10 88,391,501 (GRCm39) missense probably damaging 1.00
R9081:Mybpc1 UTSW 10 88,389,168 (GRCm39) missense probably damaging 1.00
R9172:Mybpc1 UTSW 10 88,379,615 (GRCm39) missense possibly damaging 0.93
R9323:Mybpc1 UTSW 10 88,360,829 (GRCm39) critical splice donor site probably null
R9460:Mybpc1 UTSW 10 88,372,197 (GRCm39) missense probably damaging 0.99
R9488:Mybpc1 UTSW 10 88,379,624 (GRCm39) missense possibly damaging 0.47
R9757:Mybpc1 UTSW 10 88,372,257 (GRCm39) missense probably damaging 1.00
R9796:Mybpc1 UTSW 10 88,406,497 (GRCm39) missense possibly damaging 0.56
Z1176:Mybpc1 UTSW 10 88,396,189 (GRCm39) missense probably benign
Z1177:Mybpc1 UTSW 10 88,409,299 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTAGAGGGGCGATTGCTTCTC -3'
(R):5'- GCTTTGGGTTGACACTAATTGGAC -3'

Sequencing Primer
(F):5'- CGATTGCTTCTCTGGGCTGAAG -3'
(R):5'- CAGCTTTATCCTTGATGCT -3'
Posted On 2014-10-02