Incidental Mutation 'R2200:Cyp4f16'
ID 238628
Institutional Source Beutler Lab
Gene Symbol Cyp4f16
Ensembl Gene ENSMUSG00000048440
Gene Name cytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms
MMRRC Submission 040202-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2200 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 32536558-32551798 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32537104 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 36 (A36S)
Ref Sequence ENSEMBL: ENSMUSP00000126845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003416] [ENSMUST00000165515] [ENSMUST00000169252] [ENSMUST00000169591]
AlphaFold Q99N17
Predicted Effect probably benign
Transcript: ENSMUST00000003416
AA Change: A36S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000003416
Gene: ENSMUSG00000048440
AA Change: A36S

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164628
Predicted Effect probably damaging
Transcript: ENSMUST00000165515
AA Change: A36S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126845
Gene: ENSMUSG00000048440
AA Change: A36S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169252
AA Change: A36S

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128349
Gene: ENSMUSG00000048440
AA Change: A36S

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169591
AA Change: A36S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131058
Gene: ENSMUSG00000048440
AA Change: A36S

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170956
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer1 T C 17: 56,958,423 I135M probably benign Het
Ano7 A G 1: 93,380,436 E63G possibly damaging Het
Asah1 A G 8: 41,343,728 probably null Het
B3gat2 C T 1: 23,762,792 P53L probably benign Het
Bmp8b A T 4: 123,123,022 M339L possibly damaging Het
Bpifb9b C A 2: 154,313,654 Q358K probably benign Het
Cbs T C 17: 31,624,264 D231G probably damaging Het
Chd6 A G 2: 160,983,753 Y1144H probably damaging Het
Clca3a2 T A 3: 144,813,924 I230L probably benign Het
Clec2d A T 6: 129,184,868 T155S possibly damaging Het
Cpxm1 G T 2: 130,393,197 F567L probably damaging Het
Dnah17 T C 11: 118,102,409 probably benign Het
Eml5 T C 12: 98,825,417 D1280G probably damaging Het
Ergic1 C A 17: 26,641,592 A218D possibly damaging Het
Eva1a A G 6: 82,091,913 R74G probably benign Het
Fam160a1 A G 3: 85,730,321 S224P probably damaging Het
Fus T A 7: 127,977,228 N273K probably damaging Het
Ipo13 A C 4: 117,904,903 probably null Het
Itgb3 T A 11: 104,640,986 probably null Het
Lrif1 T A 3: 106,734,558 S63R probably damaging Het
Lrig3 A G 10: 125,996,609 probably null Het
Lrp1b A T 2: 41,284,165 N1547K probably benign Het
Mme A T 3: 63,380,292 N738I possibly damaging Het
Morc2a A G 11: 3,683,919 N677S probably benign Het
Mrpl35 A C 6: 71,817,739 L82V probably benign Het
Mybpc1 A T 10: 88,555,695 N313K probably damaging Het
Podn T C 4: 108,022,590 D66G probably damaging Het
Ptpru A T 4: 131,820,813 N52K probably damaging Het
Pyroxd1 G T 6: 142,359,082 R345L probably benign Het
Qser1 A G 2: 104,789,013 S485P probably damaging Het
Rbm46 A T 3: 82,864,044 D421E probably benign Het
Rgs10 T C 7: 128,389,037 E109G probably damaging Het
Samd8 C T 14: 21,775,320 P178S probably benign Het
Scaf11 T C 15: 96,420,523 K387E probably damaging Het
Sccpdh G T 1: 179,670,606 V72F possibly damaging Het
Sec22a A T 16: 35,314,157 V285E probably damaging Het
Slc19a3 A G 1: 83,022,943 S118P probably damaging Het
Sun1 C A 5: 139,231,219 R338S probably benign Het
Taf1c A G 8: 119,598,678 F815S probably benign Het
Zcchc14 A T 8: 121,605,428 probably benign Het
Other mutations in Cyp4f16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02941:Cyp4f16 APN 17 32537087 missense possibly damaging 0.75
IGL03400:Cyp4f16 APN 17 32550353 missense probably benign 0.00
R0437:Cyp4f16 UTSW 17 32537098 missense possibly damaging 0.46
R0454:Cyp4f16 UTSW 17 32537087 missense probably damaging 0.97
R0482:Cyp4f16 UTSW 17 32550551 missense probably damaging 1.00
R1422:Cyp4f16 UTSW 17 32542999 missense probably damaging 0.99
R1435:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1440:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1616:Cyp4f16 UTSW 17 32542968 nonsense probably null
R1840:Cyp4f16 UTSW 17 32543006 critical splice donor site probably null
R1854:Cyp4f16 UTSW 17 32537099 missense probably damaging 0.99
R1912:Cyp4f16 UTSW 17 32545044 missense probably damaging 0.99
R3803:Cyp4f16 UTSW 17 32544884 missense possibly damaging 0.96
R4811:Cyp4f16 UTSW 17 32545106 missense probably benign
R4812:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R4837:Cyp4f16 UTSW 17 32542764 missense possibly damaging 0.59
R4867:Cyp4f16 UTSW 17 32550750 missense possibly damaging 0.94
R4909:Cyp4f16 UTSW 17 32550321 missense possibly damaging 0.46
R5857:Cyp4f16 UTSW 17 32537024 missense probably damaging 1.00
R5986:Cyp4f16 UTSW 17 32544142 missense probably benign 0.45
R6013:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R6408:Cyp4f16 UTSW 17 32551199 missense probably damaging 1.00
R6651:Cyp4f16 UTSW 17 32544144 missense probably benign 0.00
R7463:Cyp4f16 UTSW 17 32550787 missense possibly damaging 0.89
R7923:Cyp4f16 UTSW 17 32546747 missense possibly damaging 0.67
RF005:Cyp4f16 UTSW 17 32545195 splice site probably null
X0017:Cyp4f16 UTSW 17 32544936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCATGCTCAAAATTCTGAAG -3'
(R):5'- TGTGATGAGAATAGGGGCCC -3'

Sequencing Primer
(F):5'- GCTCAAAATTCTGAAGTTTTCCAGG -3'
(R):5'- AGGGGCCCAAATAACTTTCTTTGC -3'
Posted On 2014-10-02