Incidental Mutation 'R2201:Tgm7'
ID238636
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Nametransglutaminase 7
SynonymsTGz
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2201 (G1)
Quality Score204
Status Validated
Chromosome2
Chromosomal Location121093565-121109795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121098581 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 278 (F278Y)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
Predicted Effect probably damaging
Transcript: ENSMUST00000110675
AA Change: F278Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: F278Y

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Meta Mutation Damage Score 0.1102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 121106915 missense probably benign 0.16
IGL01576:Tgm7 APN 2 121101033 missense probably damaging 1.00
IGL01982:Tgm7 APN 2 121093625 nonsense probably null
IGL02077:Tgm7 APN 2 121103835 missense probably damaging 1.00
IGL02135:Tgm7 APN 2 121099038 missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 121094096 missense probably benign 0.01
R0412:Tgm7 UTSW 2 121101065 missense probably damaging 1.00
R1869:Tgm7 UTSW 2 121101089 missense probably damaging 1.00
R2276:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2279:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R4523:Tgm7 UTSW 2 121098588 critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 121094021 missense probably benign 0.06
R4757:Tgm7 UTSW 2 121096389 missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 121098964 critical splice donor site probably null
R5132:Tgm7 UTSW 2 121104219 missense probably damaging 1.00
R5141:Tgm7 UTSW 2 121100999 missense probably benign 0.05
R5424:Tgm7 UTSW 2 121099041 missense probably damaging 1.00
R5911:Tgm7 UTSW 2 121095973 missense probably benign 0.27
R6166:Tgm7 UTSW 2 121099058 missense probably damaging 1.00
R6364:Tgm7 UTSW 2 121096397 nonsense probably null
R6636:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6637:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6950:Tgm7 UTSW 2 121093647 missense probably damaging 1.00
R7094:Tgm7 UTSW 2 121099008 missense probably damaging 1.00
R7536:Tgm7 UTSW 2 121096397 nonsense probably null
R7729:Tgm7 UTSW 2 121093710 missense probably benign
R7822:Tgm7 UTSW 2 121103940 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTGCTAATTGCTTTCCCAATG -3'
(R):5'- TCTCTGGGATGAGCAGTGAG -3'

Sequencing Primer
(F):5'- GCTTTCCCAATGTAACTGGTG -3'
(R):5'- CTTTGCCTGTAAAGTCAAGAAGATGG -3'
Posted On2014-10-02