Incidental Mutation 'R2201:Dnase2b'
ID238642
Institutional Source Beutler Lab
Gene Symbol Dnase2b
Ensembl Gene ENSMUSG00000028185
Gene Namedeoxyribonuclease II beta
SynonymsDlad, DnaseIIb
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146580985-146615596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146584688 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 176 (D176V)
Ref Sequence ENSEMBL: ENSMUSP00000142872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029836] [ENSMUST00000199489] [ENSMUST00000200633]
Predicted Effect probably damaging
Transcript: ENSMUST00000029836
AA Change: D176V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029836
Gene: ENSMUSG00000028185
AA Change: D176V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 27 353 1.5e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199489
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200633
AA Change: D176V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185
AA Change: D176V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 26 353 4.5e-117 PFAM
Meta Mutation Damage Score 0.5270 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares considerable sequence similarity to, and is structurally related to DNase II. The latter is a well characterized endonuclease that catalyzes DNA hydrolysis in the absence of divalent cations at acidic pH. Unlike DNase II which is ubiquitously expressed, expression of this gene product is restricted to the salivary gland and lungs. The gene has been localized to chromosome 1p22.3 adjacent (and in opposite orientation) to the uricase pseudogene. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: The inability of homozygous mutant mice to degrade DNA in differentiating lens cells leads to cataract formation in the nucleus lentis. Consequently, mutant mice exhibit an impaired response to light. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Dnase2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Dnase2b APN 3 146596378 missense probably benign 0.34
IGL01626:Dnase2b APN 3 146584616 intron probably null
IGL02582:Dnase2b APN 3 146589085 missense probably benign 0.00
IGL02970:Dnase2b APN 3 146582506 missense probably damaging 0.97
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0006:Dnase2b UTSW 3 146582489 missense probably damaging 0.99
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0233:Dnase2b UTSW 3 146582550 missense probably benign 0.01
R0539:Dnase2b UTSW 3 146589155 splice site probably benign
R1544:Dnase2b UTSW 3 146584557 missense probably benign 0.03
R3690:Dnase2b UTSW 3 146593571 nonsense probably null
R4921:Dnase2b UTSW 3 146593441 missense probably damaging 1.00
R5318:Dnase2b UTSW 3 146582455 missense probably benign 0.02
R6226:Dnase2b UTSW 3 146584563 missense probably benign
R6593:Dnase2b UTSW 3 146586911 missense probably damaging 1.00
R6781:Dnase2b UTSW 3 146582371 missense probably benign 0.40
R7035:Dnase2b UTSW 3 146582341 missense probably damaging 1.00
R7314:Dnase2b UTSW 3 146582396 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATTTTGCAAAATGGACGAAGT -3'
(R):5'- CTCCCTCCCCTGAAAAGATTACA -3'

Sequencing Primer
(F):5'- ACGAAGTTTAGACCCTGGGCTG -3'
(R):5'- CCCTCCCCTGAAAAGATTACATATAC -3'
Posted On2014-10-02