Incidental Mutation 'R2201:Vmn2r14'
ID238649
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Namevomeronasal 2, receptor 14
SynonymsEG231591
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R2201 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109215502-109224622 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 109218832 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
Predicted Effect probably null
Transcript: ENSMUST00000170341
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109216314 nonsense probably null
IGL01504:Vmn2r14 APN 5 109221419 missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109224577 missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109220409 missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109224483 missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109220067 missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109220588 nonsense probably null
IGL02676:Vmn2r14 APN 5 109220016 missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109221439 missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109220188 missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109221426 missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109216394 missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109216107 missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109220484 missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109219836 missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109219044 missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109218896 missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109216360 missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109224574 missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109216251 missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109220329 missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109215996 missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109221417 missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109219972 missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109219047 nonsense probably null
R2013:Vmn2r14 UTSW 5 109221243 missense probably benign 0.00
R2417:Vmn2r14 UTSW 5 109224463 missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109215910 missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109224565 missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109216229 missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109220167 missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109216064 missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4224:Vmn2r14 UTSW 5 109216283 missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109216411 critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109221504 missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109216110 missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109221518 splice site probably null
R4896:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109220380 missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109216095 missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109217576 missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109221288 missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109220395 missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109219950 missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109217620 missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109215858 missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109221356 missense probably benign
R5985:Vmn2r14 UTSW 5 109220216 missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109221417 missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109221267 missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109216230 missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109216059 missense probably benign 0.22
R6944:Vmn2r14 UTSW 5 109216274 missense probably benign 0.06
R7608:Vmn2r14 UTSW 5 109221410 missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109220220 missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109221353 missense probably benign 0.02
R7955:Vmn2r14 UTSW 5 109221353 missense probably benign 0.02
R8006:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109220458 missense probably benign 0.41
Z1177:Vmn2r14 UTSW 5 109219875 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CACACAGAATCAGAAAATTCCTTGG -3'
(R):5'- TACTAACCCTGTTGGAGAACTGG -3'

Sequencing Primer
(F):5'- GTGCGCTAATGAACTTGGAATCC -3'
(R):5'- CCCTGTTGGAGAACTGGTGAAC -3'
Posted On2014-10-02