Incidental Mutation 'R2201:Fam160a2'
ID238661
Institutional Source Beutler Lab
Gene Symbol Fam160a2
Ensembl Gene ENSMUSG00000044465
Gene Namefamily with sequence similarity 160, member A2
Synonyms4632419K20Rik, 6530415H11Rik
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105371211-105400054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105388191 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 395 (N395S)
Ref Sequence ENSEMBL: ENSMUSP00000074252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048079] [ENSMUST00000074686] [ENSMUST00000118726] [ENSMUST00000122327] [ENSMUST00000137158] [ENSMUST00000179474] [ENSMUST00000210448] [ENSMUST00000211549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048079
AA Change: N395S

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045084
Gene: ENSMUSG00000044465
AA Change: N395S

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 2.8e-99 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074686
AA Change: N395S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074252
Gene: ENSMUSG00000044465
AA Change: N395S

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.4e-100 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 825 840 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118726
AA Change: N395S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112605
Gene: ENSMUSG00000044465
AA Change: N395S

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 1.8e-99 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122327
AA Change: N395S

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112711
Gene: ENSMUSG00000044465
AA Change: N395S

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 5.6e-98 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136298
Predicted Effect probably benign
Transcript: ENSMUST00000137158
SMART Domains Protein: ENSMUSP00000119184
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 259 7.2e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179474
AA Change: N395S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465
AA Change: N395S

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210341
Predicted Effect probably benign
Transcript: ENSMUST00000210448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211013
Predicted Effect probably benign
Transcript: ENSMUST00000211549
Meta Mutation Damage Score 0.2698 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the FTS/Hook/FHIP (FHF) complex, which can interact with members of the homotypic vesicular protein sorting (HOPS) complex. This interaction suggests that the encoded protein is involved in vesicle trafficking. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Fam160a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Fam160a2 APN 7 105388260 missense probably damaging 1.00
IGL01972:Fam160a2 APN 7 105390145 missense probably damaging 0.99
IGL02054:Fam160a2 APN 7 105384423 missense probably damaging 1.00
IGL03037:Fam160a2 APN 7 105379086 missense probably benign 0.04
IGL03278:Fam160a2 APN 7 105385124 missense possibly damaging 0.93
IGL03340:Fam160a2 APN 7 105389310 missense probably damaging 1.00
IGL03374:Fam160a2 APN 7 105383951 missense probably damaging 1.00
R0426:Fam160a2 UTSW 7 105389473 missense probably damaging 1.00
R0482:Fam160a2 UTSW 7 105384212 missense possibly damaging 0.87
R0586:Fam160a2 UTSW 7 105389447 missense probably damaging 1.00
R0686:Fam160a2 UTSW 7 105388309 missense probably damaging 1.00
R1617:Fam160a2 UTSW 7 105385062 missense probably damaging 1.00
R2025:Fam160a2 UTSW 7 105388936 missense probably damaging 1.00
R2042:Fam160a2 UTSW 7 105384121 nonsense probably null
R2049:Fam160a2 UTSW 7 105389839 missense probably damaging 1.00
R3778:Fam160a2 UTSW 7 105388228 missense probably damaging 1.00
R4094:Fam160a2 UTSW 7 105388218 missense probably damaging 1.00
R4348:Fam160a2 UTSW 7 105385349 missense probably damaging 1.00
R4482:Fam160a2 UTSW 7 105389674 missense probably benign 0.06
R4609:Fam160a2 UTSW 7 105388224 missense probably damaging 1.00
R4742:Fam160a2 UTSW 7 105384311 missense probably damaging 0.99
R4977:Fam160a2 UTSW 7 105389335 missense probably damaging 1.00
R5642:Fam160a2 UTSW 7 105389882 missense probably damaging 1.00
R6404:Fam160a2 UTSW 7 105384991 nonsense probably null
R6906:Fam160a2 UTSW 7 105388269 missense probably damaging 1.00
R7053:Fam160a2 UTSW 7 105384572 missense probably damaging 1.00
R7265:Fam160a2 UTSW 7 105384225 missense probably benign 0.00
R7808:Fam160a2 UTSW 7 105384525 missense probably damaging 1.00
X0022:Fam160a2 UTSW 7 105389709 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCCTGAAAGATAACTGTGC -3'
(R):5'- TCATCCAGACCTCTGTGGAG -3'

Sequencing Primer
(F):5'- GCAGATGCACATAGGATGAAAAC -3'
(R):5'- CTGTGGAGGAGATGATTGCGAGTAC -3'
Posted On2014-10-02