Incidental Mutation 'R2201:Polr3e'
ID238662
Institutional Source Beutler Lab
Gene Symbol Polr3e
Ensembl Gene ENSMUSG00000030880
Gene Namepolymerase (RNA) III (DNA directed) polypeptide E
SynonymsSin, RPC5
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2201 (G1)
Quality Score218
Status Validated
Chromosome7
Chromosomal Location120917744-120947432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120932242 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 185 (Y185H)
Ref Sequence ENSEMBL: ENSMUSP00000146970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033173] [ENSMUST00000106483] [ENSMUST00000207481]
Predicted Effect probably benign
Transcript: ENSMUST00000033173
AA Change: Y211H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033173
Gene: ENSMUSG00000030880
AA Change: Y211H

DomainStartEndE-ValueType
Pfam:Sin_N 5 432 7.1e-161 PFAM
coiled coil region 458 491 N/A INTRINSIC
low complexity region 504 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106483
AA Change: Y211H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102092
Gene: ENSMUSG00000030880
AA Change: Y211H

DomainStartEndE-ValueType
Pfam:Sin_N 4 29 2.8e-10 PFAM
Pfam:Sin_N 29 408 6.9e-141 PFAM
coiled coil region 432 465 N/A INTRINSIC
low complexity region 478 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207481
AA Change: Y185H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209014
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Polr3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Polr3e APN 7 120940811 nonsense probably null
IGL01664:Polr3e APN 7 120931317 splice site probably benign
IGL01980:Polr3e APN 7 120940296 splice site probably benign
IGL02027:Polr3e APN 7 120930963 missense probably damaging 1.00
IGL02208:Polr3e APN 7 120932140 missense probably damaging 0.99
IGL02549:Polr3e APN 7 120939759 missense probably damaging 1.00
IGL03338:Polr3e APN 7 120937620 missense probably benign 0.06
R1192:Polr3e UTSW 7 120933308 missense probably benign 0.03
R1328:Polr3e UTSW 7 120933823 splice site probably benign
R1435:Polr3e UTSW 7 120940788 missense probably benign 0.16
R1528:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R1754:Polr3e UTSW 7 120939298 critical splice donor site probably null
R1924:Polr3e UTSW 7 120940597 missense probably damaging 1.00
R2169:Polr3e UTSW 7 120932137 missense probably damaging 1.00
R2362:Polr3e UTSW 7 120942564 missense probably damaging 1.00
R2696:Polr3e UTSW 7 120933377 missense probably damaging 1.00
R4416:Polr3e UTSW 7 120939057 critical splice donor site probably null
R5278:Polr3e UTSW 7 120922961 missense possibly damaging 0.67
R5560:Polr3e UTSW 7 120922949 missense possibly damaging 0.83
R5689:Polr3e UTSW 7 120940689 missense possibly damaging 0.82
R5790:Polr3e UTSW 7 120927967 missense probably damaging 1.00
R6242:Polr3e UTSW 7 120940467 missense possibly damaging 0.62
R6317:Polr3e UTSW 7 120927982 missense possibly damaging 0.49
R6334:Polr3e UTSW 7 120927999 missense possibly damaging 0.87
R6891:Polr3e UTSW 7 120944650 missense probably damaging 0.98
R7110:Polr3e UTSW 7 120940287 splice site probably null
R7771:Polr3e UTSW 7 120940578 missense probably benign
R7809:Polr3e UTSW 7 120924226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGGCTGAATTCCAAAAGC -3'
(R):5'- GGGGCTAAACCTCTAACTGG -3'

Sequencing Primer
(F):5'- GCTGAATTCCAAAAGCAAAGTG -3'
(R):5'- TGGAACAGGAGCTCTCTGC -3'
Posted On2014-10-02