Incidental Mutation 'R2201:Pias1'
ID238668
Institutional Source Beutler Lab
Gene Symbol Pias1
Ensembl Gene ENSMUSG00000032405
Gene Nameprotein inhibitor of activated STAT 1
SynonymsDdxbp1, GBP, 2900068C24Rik
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62878368-62987924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62951855 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 124 (H124N)
Ref Sequence ENSEMBL: ENSMUSP00000150834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098651] [ENSMUST00000214830] [ENSMUST00000216209]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098651
AA Change: H124N

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000096248
Gene: ENSMUSG00000032405
AA Change: H124N

DomainStartEndE-ValueType
SAP 11 45 5.3e-5 SMART
low complexity region 82 95 N/A INTRINSIC
low complexity region 103 116 N/A INTRINSIC
Pfam:PINIT 135 286 9.6e-41 PFAM
Pfam:zf-MIZ 331 380 1.4e-23 PFAM
low complexity region 465 474 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000214830
AA Change: H124N

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215455
Predicted Effect possibly damaging
Transcript: ENSMUST00000216209
AA Change: H115N

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein inhibitor of activated STAT (PIAS) family. PIAS proteins function as SUMO E3 ligases and play important roles in many cellular processes by mediating the sumoylation of target proteins. This protein plays a central role as a transcriptional coregulator of numerous cellular pathways includign the STAT1 and nuclear factor kappaB pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial perinatal lethality, reduced body size, decreased susceptibility to viral infection, and increased susceptibility to bacterial infection and LPS-induced endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Pias1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pias1 APN 9 62923296 missense probably damaging 0.96
IGL01011:Pias1 APN 9 62912855 missense probably benign 0.00
IGL02412:Pias1 APN 9 62893139 missense probably benign 0.44
IGL02728:Pias1 APN 9 62923644 missense probably damaging 1.00
IGL02728:Pias1 APN 9 62923645 missense possibly damaging 0.80
R0479:Pias1 UTSW 9 62893118 splice site probably benign
R0494:Pias1 UTSW 9 62887311 nonsense probably null
R0524:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R0558:Pias1 UTSW 9 62882009 missense possibly damaging 0.82
R1279:Pias1 UTSW 9 62892145 missense probably damaging 0.98
R1525:Pias1 UTSW 9 62920487 missense probably damaging 1.00
R1769:Pias1 UTSW 9 62952178 missense probably damaging 1.00
R2157:Pias1 UTSW 9 62912830 missense possibly damaging 0.63
R4193:Pias1 UTSW 9 62952004 missense possibly damaging 0.80
R4726:Pias1 UTSW 9 62920489 missense probably damaging 0.96
R4880:Pias1 UTSW 9 62912798 missense probably benign 0.32
R5107:Pias1 UTSW 9 62882228 missense probably benign 0.11
R5574:Pias1 UTSW 9 62920493 missense probably damaging 0.99
R5634:Pias1 UTSW 9 62895973 missense probably benign 0.10
R5869:Pias1 UTSW 9 62912766 missense probably benign 0.06
R6518:Pias1 UTSW 9 62951860 missense probably damaging 1.00
R6634:Pias1 UTSW 9 62919424 missense probably damaging 1.00
R6798:Pias1 UTSW 9 62892169 missense probably benign
R6799:Pias1 UTSW 9 62882052 missense probably benign 0.10
R7099:Pias1 UTSW 9 62881145 missense
X0017:Pias1 UTSW 9 62980845 splice site probably null
Z1177:Pias1 UTSW 9 62912823 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCGTTAACATCCTGACACTACTACC -3'
(R):5'- AGAACTCTACAGGAGGCGGTTC -3'

Sequencing Primer
(F):5'- CTACTACCAAACATAAACCGAGTC -3'
(R):5'- GGCGGTTCCCTCAGAAAATTATGAC -3'
Posted On2014-10-02