Mutagenetix > Incidental Mutations

Incidental Mutation 'R2201:Myo5a'

238670

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

040203-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R2201 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75217943 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1838 (T1838A)

Ref Sequence

ENSEMBL: ENSMUSP00000116028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]

PDB Structure

Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123128
AA Change: T1838A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: T1838A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136604

Predicted Effect

probably benign
Transcript: ENSMUST00000136731
AA Change: T1813A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: T1813A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000148144
AA Change: T570A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: T570A

Domain	Start	End	E-Value	Type
coiled coil region	71	175	N/A	INTRINSIC
Blast:DIL	275	305	4e-13	BLAST
Blast:DIL	330	355	5e-6	BLAST
DIL	417	522	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155282
AA Change: T1840A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: T1840A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.0704

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	A	7: 29,536,525		noncoding transcript	Het
A2ml1	A	T	6: 128,547,305	N1121K	probably null	Het
Actr10	A	G	12: 70,960,021	N351D	probably damaging	Het
Adcy7	G	A	8: 88,317,978	A500T	probably damaging	Het
Ankrd35	T	C	3: 96,679,248	I80T	possibly damaging	Het
Arap2	G	A	5: 62,706,685	T532I	probably damaging	Het
Bag3	AAAGG	AAAGGAAGG	7: 128,545,769		probably null	Het
C77080	A	G	4: 129,222,639	V732A	probably benign	Het
Cc2d2a	T	C	5: 43,684,033		probably benign	Het
Cep85l	A	T	10: 53,348,731	M254K	probably benign	Het
Clic4	A	G	4: 135,223,539	S114P	probably damaging	Het
Ctsj	T	C	13: 61,002,549	Y213C	probably damaging	Het
Ddx28	A	G	8: 106,010,574	V284A	probably damaging	Het
Dnase2b	T	A	3: 146,584,688	D176V	probably damaging	Het
Dsg2	T	A	18: 20,596,054	N663K	probably damaging	Het
Dst	T	A	1: 34,195,921	S3694T	possibly damaging	Het
Emilin1	T	C	5: 30,915,692	S158P	probably benign	Het
Eng	T	C	2: 32,673,740		probably benign	Het
Fam160a2	T	C	7: 105,388,191	N395S	probably damaging	Het
Fam189a1	T	A	7: 64,759,393	M418L	probably benign	Het
Fdxr	C	A	11: 115,270,382	V223L	probably benign	Het
Frem2	T	A	3: 53,516,573	M3148L	probably benign	Het
Hip1	A	T	5: 135,431,730	D114E	probably benign	Het
Itga9	T	C	9: 118,877,115		probably benign	Het
Kcnt2	T	A	1: 140,509,441	N487K	probably damaging	Het
Krt6a	A	G	15: 101,693,171	F172L	probably benign	Het
Megf8	C	T	7: 25,340,745	R1034W	probably damaging	Het
Muc6	C	T	7: 141,649,810	D451N	probably damaging	Het
N4bp2l2	A	T	5: 150,661,608	D302E	probably damaging	Het
Nbeal2	T	A	9: 110,630,250	I1930F	probably benign	Het
Npas4	A	T	19: 4,987,364	Y301N	probably benign	Het
Nt5m	A	G	11: 59,875,915	K211E	probably benign	Het
Pfn4	A	G	12: 4,774,382		probably null	Het
Pfpl	A	C	19: 12,430,479	D698A	probably benign	Het
Pias1	G	T	9: 62,951,855	H124N	possibly damaging	Het
Pja2	A	T	17: 64,311,167		probably benign	Het
Polr3e	T	C	7: 120,932,242	Y185H	probably benign	Het
Pomc	T	C	12: 3,960,275	L172S	probably benign	Het
Rapgef4	A	G	2: 72,045,189	T129A	probably damaging	Het
Reep1	T	C	6: 71,773,294	S97P	probably damaging	Het
Rttn	T	A	18: 89,010,943	I595N	possibly damaging	Het
Sap30	T	C	8: 57,485,472		probably null	Het
Slc1a7	T	C	4: 107,993,006	Y105H	probably damaging	Het
Slc5a5	C	T	8: 70,892,458	M68I	probably damaging	Het
Stab2	T	A	10: 86,940,639	Y791F	probably benign	Het
Tdrd1	C	A	19: 56,858,661	S911R	probably benign	Het
Tdrd1	C	A	19: 56,858,662	H912N	probably benign	Het
Tgm7	A	T	2: 121,098,581	F278Y	probably damaging	Het
Tln2	T	C	9: 67,375,757	T310A	probably damaging	Het
Tmem256	T	C	11: 69,839,445	I93T	probably benign	Het
Trpm2	G	A	10: 77,920,471	Q1172*	probably null	Het
Ttll8	A	G	15: 88,933,953	V173A	possibly damaging	Het
Ubr5	T	C	15: 38,002,299	S1497G	possibly damaging	Het
Ubr7	G	A	12: 102,761,505		probably null	Het
Vmn1r37	T	A	6: 66,731,894	M1K	probably null	Het
Vmn2r14	A	G	5: 109,218,832		probably null	Het
Vmn2r72	T	C	7: 85,738,236	I707V	probably benign	Het
Vps8	A	G	16: 21,576,757	R1266G	probably damaging	Het
Zfhx4	A	G	3: 5,242,289	N192D	probably damaging	Het
Zfp638	G	C	6: 83,929,518	D222H	probably damaging	Het
Zscan29	A	C	2: 121,169,402	V106G	probably damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R0601:Myo5a	UTSW	9	75174015	missense	probably benign	0.01
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- CCGCACTATACAGGTAAGAGGC -3'
(R):5'- TCAATCGAAAGGATTCTGGGG -3'

Sequencing Primer
(F):5'- GCACTATACAGGTAAGAGGCTTTTTC -3'
(R):5'- GGGGAGGGGTGGATTTCC -3'

Posted On

2014-10-02