Incidental Mutation 'R2201:Krt6a'
ID238685
Institutional Source Beutler Lab
Gene Symbol Krt6a
Ensembl Gene ENSMUSG00000058354
Gene Namekeratin 6A
SynonymsKrt2-6a, MK6a, mK6[a], Krt2-6c
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R2201 (G1)
Quality Score223
Status Validated
Chromosome15
Chromosomal Location101689910-101694307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101693171 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 172 (F172L)
Ref Sequence ENSEMBL: ENSMUSP00000023788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023788]
Predicted Effect probably benign
Transcript: ENSMUST00000023788
AA Change: F172L

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023788
Gene: ENSMUSG00000058354
AA Change: F172L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 4.1e-36 PFAM
Filament 151 464 7.2e-178 SMART
low complexity region 483 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230205
Meta Mutation Damage Score 0.5497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Npas4 A T 19: 4,987,364 Y301N probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Krt6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Krt6a APN 15 101692794 missense probably damaging 1.00
IGL00596:Krt6a APN 15 101694230 missense possibly damaging 0.53
PIT4468001:Krt6a UTSW 15 101693917 missense probably damaging 0.98
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0811:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0812:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0828:Krt6a UTSW 15 101693836 missense probably damaging 0.99
R0924:Krt6a UTSW 15 101690800 splice site probably benign
R1525:Krt6a UTSW 15 101694202 missense probably benign
R1591:Krt6a UTSW 15 101692357 splice site probably null
R1725:Krt6a UTSW 15 101692557 missense probably damaging 1.00
R1962:Krt6a UTSW 15 101691465 missense probably damaging 1.00
R3024:Krt6a UTSW 15 101691289 missense probably benign 0.02
R3158:Krt6a UTSW 15 101691366 missense probably damaging 1.00
R5369:Krt6a UTSW 15 101692558 missense probably benign 0.06
R5637:Krt6a UTSW 15 101692279 missense probably benign 0.25
R6164:Krt6a UTSW 15 101692573 missense probably damaging 0.99
R6320:Krt6a UTSW 15 101692309 missense probably damaging 0.99
R6562:Krt6a UTSW 15 101691659 missense probably benign 0.36
R7267:Krt6a UTSW 15 101693854 missense probably benign 0.03
R7560:Krt6a UTSW 15 101690559 missense unknown
R7621:Krt6a UTSW 15 101691752 missense possibly damaging 0.92
R7671:Krt6a UTSW 15 101690543 missense unknown
R8019:Krt6a UTSW 15 101693869 missense probably damaging 1.00
X0067:Krt6a UTSW 15 101693777 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GTGTCCTGCATGTTCCTCAG -3'
(R):5'- GTGCCCTACATGAGTTCTCTG -3'

Sequencing Primer
(F):5'- TCAGCTCTGAGTCCAGGC -3'
(R):5'- TAGTCAGACAGCCTGAGA -3'
Posted On2014-10-02