Mutagenetix > Incidental Mutation

Incidental Mutation 'R2201:Vps8'

238686

Institutional Source

Beutler Lab

Gene Symbol

Vps8

Ensembl Gene

ENSMUSG00000033653

Gene Name

VPS8 CORVET complex subunit

Synonyms

MMRRC Submission

040203-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2201 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21423118-21644680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21576757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1266 (R1266G)

Ref Sequence

ENSEMBL: ENSMUSP00000112937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118138] [ENSMUST00000118923]

AlphaFold

Q0P5W1

Predicted Effect

probably damaging
Transcript: ENSMUST00000096191
AA Change: R1266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: R1266G

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	7e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.7e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
Blast:RING	1257	1277	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000096192
AA Change: R1238G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: R1238G

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	1e-8	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.4e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115397
AA Change: R1268G

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: R1268G

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	8e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	613	796	1.3e-61	PFAM
low complexity region	994	1009	N/A	INTRINSIC
low complexity region	1087	1099	N/A	INTRINSIC
low complexity region	1128	1139	N/A	INTRINSIC
RING	1259	1310	1.23e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117598
AA Change: R1266G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: R1266G

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	8e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.9e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
RING	1257	1308	1.23e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118138

SMART Domains

Protein: ENSMUSP00000113447
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
Pfam:Vps8	1	76	7.7e-21	PFAM
low complexity region	274	289	N/A	INTRINSIC
low complexity region	367	379	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
RING	539	590	1.23e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000118923
AA Change: R1238G

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: R1238G

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	9e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.9e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000125487
AA Change: R836G

SMART Domains

Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653
AA Change: R836G

Domain	Start	End	E-Value	Type
Pfam:Vps8	182	365	8.5e-62	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	656	668	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
RING	828	879	1.23e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231484

Meta Mutation Damage Score

0.3669

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932431P20Rik	T	A	7: 29,536,525		noncoding transcript	Het
A2ml1	A	T	6: 128,547,305	N1121K	probably null	Het
Actr10	A	G	12: 70,960,021	N351D	probably damaging	Het
Adcy7	G	A	8: 88,317,978	A500T	probably damaging	Het
Ankrd35	T	C	3: 96,679,248	I80T	possibly damaging	Het
Arap2	G	A	5: 62,706,685	T532I	probably damaging	Het
Bag3	AAAGG	AAAGGAAGG	7: 128,545,769		probably null	Het
C77080	A	G	4: 129,222,639	V732A	probably benign	Het
Cc2d2a	T	C	5: 43,684,033		probably benign	Het
Cep85l	A	T	10: 53,348,731	M254K	probably benign	Het
Clic4	A	G	4: 135,223,539	S114P	probably damaging	Het
Ctsj	T	C	13: 61,002,549	Y213C	probably damaging	Het
Ddx28	A	G	8: 106,010,574	V284A	probably damaging	Het
Dnase2b	T	A	3: 146,584,688	D176V	probably damaging	Het
Dsg2	T	A	18: 20,596,054	N663K	probably damaging	Het
Dst	T	A	1: 34,195,921	S3694T	possibly damaging	Het
Emilin1	T	C	5: 30,915,692	S158P	probably benign	Het
Eng	T	C	2: 32,673,740		probably benign	Het
Fam160a2	T	C	7: 105,388,191	N395S	probably damaging	Het
Fam189a1	T	A	7: 64,759,393	M418L	probably benign	Het
Fdxr	C	A	11: 115,270,382	V223L	probably benign	Het
Frem2	T	A	3: 53,516,573	M3148L	probably benign	Het
Hip1	A	T	5: 135,431,730	D114E	probably benign	Het
Itga9	T	C	9: 118,877,115		probably benign	Het
Kcnt2	T	A	1: 140,509,441	N487K	probably damaging	Het
Krt6a	A	G	15: 101,693,171	F172L	probably benign	Het
Megf8	C	T	7: 25,340,745	R1034W	probably damaging	Het
Muc6	C	T	7: 141,649,810	D451N	probably damaging	Het
Myo5a	A	G	9: 75,217,943	T1838A	possibly damaging	Het
N4bp2l2	A	T	5: 150,661,608	D302E	probably damaging	Het
Nbeal2	T	A	9: 110,630,250	I1930F	probably benign	Het
Npas4	A	T	19: 4,987,364	Y301N	probably benign	Het
Nt5m	A	G	11: 59,875,915	K211E	probably benign	Het
Pfn4	A	G	12: 4,774,382		probably null	Het
Pfpl	A	C	19: 12,430,479	D698A	probably benign	Het
Pias1	G	T	9: 62,951,855	H124N	possibly damaging	Het
Pja2	A	T	17: 64,311,167		probably benign	Het
Polr3e	T	C	7: 120,932,242	Y185H	probably benign	Het
Pomc	T	C	12: 3,960,275	L172S	probably benign	Het
Rapgef4	A	G	2: 72,045,189	T129A	probably damaging	Het
Reep1	T	C	6: 71,773,294	S97P	probably damaging	Het
Rttn	T	A	18: 89,010,943	I595N	possibly damaging	Het
Sap30	T	C	8: 57,485,472		probably null	Het
Slc1a7	T	C	4: 107,993,006	Y105H	probably damaging	Het
Slc5a5	C	T	8: 70,892,458	M68I	probably damaging	Het
Stab2	T	A	10: 86,940,639	Y791F	probably benign	Het
Tdrd1	C	A	19: 56,858,661	S911R	probably benign	Het
Tdrd1	C	A	19: 56,858,662	H912N	probably benign	Het
Tgm7	A	T	2: 121,098,581	F278Y	probably damaging	Het
Tln2	T	C	9: 67,375,757	T310A	probably damaging	Het
Tmem256	T	C	11: 69,839,445	I93T	probably benign	Het
Trpm2	G	A	10: 77,920,471	Q1172*	probably null	Het
Ttll8	A	G	15: 88,933,953	V173A	possibly damaging	Het
Ubr5	T	C	15: 38,002,299	S1497G	possibly damaging	Het
Ubr7	G	A	12: 102,761,505		probably null	Het
Vmn1r37	T	A	6: 66,731,894	M1K	probably null	Het
Vmn2r14	A	G	5: 109,218,832		probably null	Het
Vmn2r72	T	C	7: 85,738,236	I707V	probably benign	Het
Zfhx4	A	G	3: 5,242,289	N192D	probably damaging	Het
Zfp638	G	C	6: 83,929,518	D222H	probably damaging	Het
Zscan29	A	C	2: 121,169,402	V106G	probably damaging	Het

Other mutations in Vps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Vps8	APN	16	21442334	missense	possibly damaging	0.47
IGL00596:Vps8	APN	16	21448412	splice site	probably benign
IGL00985:Vps8	APN	16	21477584	splice site	probably benign
IGL01356:Vps8	APN	16	21517357	critical splice donor site	probably null
IGL01375:Vps8	APN	16	21559372	nonsense	probably null
IGL01643:Vps8	APN	16	21518222	missense	possibly damaging	0.92
IGL02159:Vps8	APN	16	21466484	missense	possibly damaging	0.69
IGL02214:Vps8	APN	16	21517285	missense	probably damaging	1.00
IGL02465:Vps8	APN	16	21521903	missense	probably damaging	1.00
IGL02651:Vps8	APN	16	21517336	missense	probably damaging	0.99
IGL03174:Vps8	APN	16	21466463	missense	probably damaging	1.00
IGL03337:Vps8	APN	16	21563168	missense	probably benign
IGL03383:Vps8	APN	16	21435823	critical splice donor site	probably null
IGL03402:Vps8	APN	16	21448398	missense	possibly damaging	0.68
empires	UTSW	16	21581548	nonsense	probably null
porky	UTSW	16	21461238	missense	probably benign	0.32
realm	UTSW	16	21545236	intron	probably benign
realms	UTSW	16	21444188	splice site	probably null
Reich	UTSW	16	21478439	missense	probably benign	0.29
reichen	UTSW	16	21506825	splice site	probably benign
IGL03052:Vps8	UTSW	16	21448365	missense	probably damaging	0.99
PIT4677001:Vps8	UTSW	16	21500334	missense	possibly damaging	0.94
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0125:Vps8	UTSW	16	21470154	missense	probably benign	0.00
R0137:Vps8	UTSW	16	21504386	splice site	probably benign
R0362:Vps8	UTSW	16	21608227	intron	probably benign
R0384:Vps8	UTSW	16	21506825	splice site	probably benign
R0492:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0525:Vps8	UTSW	16	21540109	critical splice donor site	probably null
R0531:Vps8	UTSW	16	21459811	intron	probably benign
R0605:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R0636:Vps8	UTSW	16	21434933	missense	probably benign	0.32
R0707:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0840:Vps8	UTSW	16	21456321	missense	probably damaging	0.99
R1170:Vps8	UTSW	16	21459820	intron	probably benign
R1203:Vps8	UTSW	16	21511557	missense	probably damaging	1.00
R1482:Vps8	UTSW	16	21581598	missense	probably benign	0.00
R1531:Vps8	UTSW	16	21466476	nonsense	probably null
R1642:Vps8	UTSW	16	21581579	missense	probably benign
R1956:Vps8	UTSW	16	21461142	missense	probably damaging	1.00
R2287:Vps8	UTSW	16	21568413	missense	probably damaging	1.00
R2423:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R3151:Vps8	UTSW	16	21442373	missense	probably benign	0.04
R3943:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R3944:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R4043:Vps8	UTSW	16	21526396	missense	probably damaging	1.00
R4302:Vps8	UTSW	16	21495914	missense	probably damaging	1.00
R4398:Vps8	UTSW	16	21504466	missense	probably damaging	1.00
R4477:Vps8	UTSW	16	21545236	intron	probably benign
R4478:Vps8	UTSW	16	21545236	intron	probably benign
R4479:Vps8	UTSW	16	21545236	intron	probably benign
R4480:Vps8	UTSW	16	21545236	intron	probably benign
R4571:Vps8	UTSW	16	21435775	missense	probably damaging	1.00
R4653:Vps8	UTSW	16	21500210	missense	probably damaging	1.00
R4664:Vps8	UTSW	16	21444188	splice site	probably null
R4713:Vps8	UTSW	16	21442439	missense	probably damaging	1.00
R4726:Vps8	UTSW	16	21448404	splice site	probably null
R4959:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4973:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4975:Vps8	UTSW	16	21466469	missense	probably damaging	1.00
R4992:Vps8	UTSW	16	21461408	missense	possibly damaging	0.52
R5144:Vps8	UTSW	16	21559353	missense	probably damaging	1.00
R5168:Vps8	UTSW	16	21457445	missense	probably damaging	0.99
R5168:Vps8	UTSW	16	21533099	missense	probably benign	0.05
R5222:Vps8	UTSW	16	21581548	nonsense	probably null
R5231:Vps8	UTSW	16	21576725	missense	probably damaging	1.00
R5876:Vps8	UTSW	16	21461439	critical splice donor site	probably null
R5963:Vps8	UTSW	16	21470121	missense	possibly damaging	0.48
R6010:Vps8	UTSW	16	21545205	intron	probably benign
R6023:Vps8	UTSW	16	21461238	missense	probably benign	0.32
R6173:Vps8	UTSW	16	21495932	splice site	probably null
R6185:Vps8	UTSW	16	21470141	missense	probably damaging	0.98
R6264:Vps8	UTSW	16	21559349	nonsense	probably null
R6409:Vps8	UTSW	16	21478439	missense	probably benign	0.29
R6522:Vps8	UTSW	16	21442379	missense	probably damaging	0.99
R6528:Vps8	UTSW	16	21554125	nonsense	probably null
R6784:Vps8	UTSW	16	21563207	missense	probably benign	0.01
R7040:Vps8	UTSW	16	21575022	missense	probably damaging	1.00
R7072:Vps8	UTSW	16	21581579	missense	probably benign
R7103:Vps8	UTSW	16	21526441	missense	probably damaging	1.00
R7149:Vps8	UTSW	16	21459776	missense	probably damaging	1.00
R7195:Vps8	UTSW	16	21456282	missense	probably damaging	1.00
R7206:Vps8	UTSW	16	21457421	missense	probably damaging	1.00
R7403:Vps8	UTSW	16	21434972	missense	possibly damaging	0.78
R7782:Vps8	UTSW	16	21511558	missense	possibly damaging	0.89
R7806:Vps8	UTSW	16	21459751	missense	probably damaging	1.00
R7846:Vps8	UTSW	16	21532320	missense	probably benign	0.01
R7943:Vps8	UTSW	16	21477872	missense	possibly damaging	0.66
R8075:Vps8	UTSW	16	21521894	missense	probably damaging	0.99
R8190:Vps8	UTSW	16	21575030	missense	possibly damaging	0.73
R8307:Vps8	UTSW	16	21495902	missense	probably benign	0.02
R8483:Vps8	UTSW	16	21575013	missense	probably damaging	0.98
R8814:Vps8	UTSW	16	21576650	missense	probably damaging	1.00
R9064:Vps8	UTSW	16	21470229	missense	probably damaging	1.00
R9367:Vps8	UTSW	16	21521918	missense	possibly damaging	0.45
R9404:Vps8	UTSW	16	21608177	missense	probably benign	0.12
R9544:Vps8	UTSW	16	21518143	missense	probably benign	0.00
R9570:Vps8	UTSW	16	21644203	missense	probably benign	0.10
R9634:Vps8	UTSW	16	21554143	missense	probably damaging	1.00
R9702:Vps8	UTSW	16	21644133	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TCATCACTGCACACGAAGGG -3'
(R):5'- ACTCCCCGGCAGACTGTAAG -3'

Sequencing Primer
(F):5'- ACTGCACACGAAGGGCTCTG -3'
(R):5'- CCGGCAGACTGTAAGGGCAG -3'

Posted On

2014-10-02