Incidental Mutation 'R2201:Npas4'
ID238690
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Nameneuronal PAS domain protein 4
SynonymsNpas4, LE-PAS, Nxf
MMRRC Submission 040203-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R2201 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4984355-4989971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4987364 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 301 (Y301N)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
Predicted Effect probably benign
Transcript: ENSMUST00000056129
AA Change: Y301N

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: Y301N

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Meta Mutation Damage Score 0.1602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik T A 7: 29,536,525 noncoding transcript Het
A2ml1 A T 6: 128,547,305 N1121K probably null Het
Actr10 A G 12: 70,960,021 N351D probably damaging Het
Adcy7 G A 8: 88,317,978 A500T probably damaging Het
Ankrd35 T C 3: 96,679,248 I80T possibly damaging Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
C77080 A G 4: 129,222,639 V732A probably benign Het
Cc2d2a T C 5: 43,684,033 probably benign Het
Cep85l A T 10: 53,348,731 M254K probably benign Het
Clic4 A G 4: 135,223,539 S114P probably damaging Het
Ctsj T C 13: 61,002,549 Y213C probably damaging Het
Ddx28 A G 8: 106,010,574 V284A probably damaging Het
Dnase2b T A 3: 146,584,688 D176V probably damaging Het
Dsg2 T A 18: 20,596,054 N663K probably damaging Het
Dst T A 1: 34,195,921 S3694T possibly damaging Het
Emilin1 T C 5: 30,915,692 S158P probably benign Het
Eng T C 2: 32,673,740 probably benign Het
Fam160a2 T C 7: 105,388,191 N395S probably damaging Het
Fam189a1 T A 7: 64,759,393 M418L probably benign Het
Fdxr C A 11: 115,270,382 V223L probably benign Het
Frem2 T A 3: 53,516,573 M3148L probably benign Het
Hip1 A T 5: 135,431,730 D114E probably benign Het
Itga9 T C 9: 118,877,115 probably benign Het
Kcnt2 T A 1: 140,509,441 N487K probably damaging Het
Krt6a A G 15: 101,693,171 F172L probably benign Het
Megf8 C T 7: 25,340,745 R1034W probably damaging Het
Muc6 C T 7: 141,649,810 D451N probably damaging Het
Myo5a A G 9: 75,217,943 T1838A possibly damaging Het
N4bp2l2 A T 5: 150,661,608 D302E probably damaging Het
Nbeal2 T A 9: 110,630,250 I1930F probably benign Het
Nt5m A G 11: 59,875,915 K211E probably benign Het
Pfn4 A G 12: 4,774,382 probably null Het
Pfpl A C 19: 12,430,479 D698A probably benign Het
Pias1 G T 9: 62,951,855 H124N possibly damaging Het
Pja2 A T 17: 64,311,167 probably benign Het
Polr3e T C 7: 120,932,242 Y185H probably benign Het
Pomc T C 12: 3,960,275 L172S probably benign Het
Rapgef4 A G 2: 72,045,189 T129A probably damaging Het
Reep1 T C 6: 71,773,294 S97P probably damaging Het
Rttn T A 18: 89,010,943 I595N possibly damaging Het
Sap30 T C 8: 57,485,472 probably null Het
Slc1a7 T C 4: 107,993,006 Y105H probably damaging Het
Slc5a5 C T 8: 70,892,458 M68I probably damaging Het
Stab2 T A 10: 86,940,639 Y791F probably benign Het
Tdrd1 C A 19: 56,858,661 S911R probably benign Het
Tdrd1 C A 19: 56,858,662 H912N probably benign Het
Tgm7 A T 2: 121,098,581 F278Y probably damaging Het
Tln2 T C 9: 67,375,757 T310A probably damaging Het
Tmem256 T C 11: 69,839,445 I93T probably benign Het
Trpm2 G A 10: 77,920,471 Q1172* probably null Het
Ttll8 A G 15: 88,933,953 V173A possibly damaging Het
Ubr5 T C 15: 38,002,299 S1497G possibly damaging Het
Ubr7 G A 12: 102,761,505 probably null Het
Vmn1r37 T A 6: 66,731,894 M1K probably null Het
Vmn2r14 A G 5: 109,218,832 probably null Het
Vmn2r72 T C 7: 85,738,236 I707V probably benign Het
Vps8 A G 16: 21,576,757 R1266G probably damaging Het
Zfhx4 A G 3: 5,242,289 N192D probably damaging Het
Zfp638 G C 6: 83,929,518 D222H probably damaging Het
Zscan29 A C 2: 121,169,402 V106G probably damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 4987327 missense possibly damaging 0.93
IGL01865:Npas4 APN 19 4985791 nonsense probably null
IGL02746:Npas4 APN 19 4986667 missense probably damaging 0.99
IGL03061:Npas4 APN 19 4986337 missense probably damaging 1.00
IGL03340:Npas4 APN 19 4985066 utr 3 prime probably benign
R0879:Npas4 UTSW 19 4986916 missense probably benign
R0920:Npas4 UTSW 19 4986316 nonsense probably null
R1751:Npas4 UTSW 19 4988183 missense probably benign 0.05
R1767:Npas4 UTSW 19 4988183 missense probably benign 0.05
R2066:Npas4 UTSW 19 4987414 missense probably damaging 0.99
R3973:Npas4 UTSW 19 4986551 missense probably benign
R4117:Npas4 UTSW 19 4987363 missense probably damaging 0.99
R4846:Npas4 UTSW 19 4986777 missense probably benign 0.34
R5007:Npas4 UTSW 19 4989656 missense possibly damaging 0.61
R6155:Npas4 UTSW 19 4986870 missense probably damaging 1.00
R6255:Npas4 UTSW 19 4986375 missense probably damaging 1.00
R6488:Npas4 UTSW 19 4985983 missense probably damaging 1.00
Z1177:Npas4 UTSW 19 4986242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGAGTTTAGCTGCTGGC -3'
(R):5'- GGCTCCCTCAATTCAGTGTAG -3'

Sequencing Primer
(F):5'- AGGCTTCCGTGTCACTGGAAAG -3'
(R):5'- CTCCCTCAATTCAGTGTAGAGGTAAG -3'
Posted On2014-10-02