Incidental Mutation 'R2202:Duox1'
ID 238708
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Name dual oxidase 1
Synonyms NOXEF1, LNOX1, 9930101G15Rik, THOX1
MMRRC Submission 040204-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2202 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 122146153-122178453 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 122175194 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1331 (T1331A)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]
AlphaFold A2AQ92
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099461
AA Change: T1331A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: T1331A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110530
SMART Domains Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
SH2 130 214 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110532
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121237
SMART Domains Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125826
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135848
Predicted Effect probably benign
Transcript: ENSMUST00000139819
SMART Domains Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
SH2 218 302 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143484
SMART Domains Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
SH2 71 155 3.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 64,056,011 (GRCm39) V249A possibly damaging Het
9930111J21Rik2 C G 11: 48,910,149 (GRCm39) L761F probably damaging Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Abca14 T C 7: 119,888,764 (GRCm39) Y1237H probably benign Het
Abi3bp C T 16: 56,471,088 (GRCm39) R578* probably null Het
Abi3bp T G 16: 56,433,566 (GRCm39) L550R probably benign Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ahdc1 A G 4: 132,793,220 (GRCm39) E1487G possibly damaging Het
AI987944 T C 7: 41,023,950 (GRCm39) E343G probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Atp1b1 G T 1: 164,281,084 (GRCm39) T11K probably benign Het
Calr3 A G 8: 73,188,683 (GRCm39) L40S probably damaging Het
Ccar1 A C 10: 62,581,066 (GRCm39) D1119E unknown Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Cdk12 T G 11: 98,101,464 (GRCm39) S441A unknown Het
Ces4a T A 8: 105,872,746 (GRCm39) V333E probably damaging Het
Cfap61 T C 2: 146,056,600 (GRCm39) L1193P probably damaging Het
Chd2 A T 7: 73,128,416 (GRCm39) D856E probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Cln3 T A 7: 126,178,390 (GRCm39) H211L probably benign Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Dcstamp T A 15: 39,617,708 (GRCm39) V39E probably damaging Het
Dicer1 C T 12: 104,697,297 (GRCm39) V87M possibly damaging Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Fam184a T A 10: 53,528,530 (GRCm39) Q29L probably damaging Het
Fcer2a T C 8: 3,738,557 (GRCm39) E60G possibly damaging Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Fnbp1l A T 3: 122,340,611 (GRCm39) M463K probably benign Het
Garem2 A G 5: 30,319,762 (GRCm39) D408G probably benign Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Gpc3 T A X: 51,486,083 (GRCm39) I344F probably damaging Het
Gtf2e1 T A 16: 37,331,904 (GRCm39) E390D possibly damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Il15ra T A 2: 11,723,155 (GRCm39) probably null Het
Ints8 A T 4: 11,225,712 (GRCm39) M615K possibly damaging Het
Irak1 G A X: 73,060,744 (GRCm39) T193I probably damaging Het
Jmjd1c A G 10: 67,075,242 (GRCm39) probably null Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Letm1 C A 5: 33,926,830 (GRCm39) V156L possibly damaging Het
Lrrc24 G A 15: 76,607,111 (GRCm39) P95L probably damaging Het
Map2k2 T C 10: 80,955,213 (GRCm39) S14P probably damaging Het
Me3 T C 7: 89,499,589 (GRCm39) Y535H probably damaging Het
Nfatc2ip T C 7: 125,990,467 (GRCm39) E178G probably benign Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10a2 T A 7: 106,673,523 (GRCm39) W163R probably damaging Het
Or2m12 C T 16: 19,105,047 (GRCm39) A149T probably benign Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Pbrm1 A G 14: 30,754,406 (GRCm39) D142G possibly damaging Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pid1 T A 1: 84,016,159 (GRCm39) I69F probably damaging Het
Pkhd1 A G 1: 20,607,584 (GRCm39) S1091P probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Plxnd1 T C 6: 115,939,725 (GRCm39) N1418S probably benign Het
Pmm1 T C 15: 81,840,601 (GRCm39) T82A probably benign Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,649 (GRCm39) T913M possibly damaging Het
Ralgapa1 T C 12: 55,659,585 (GRCm39) probably null Het
Rbm8a2 T C 1: 175,806,420 (GRCm39) E19G possibly damaging Het
Rgs3 T C 4: 62,608,741 (GRCm39) S336P probably damaging Het
Saxo5 A T 8: 3,529,028 (GRCm39) D201V probably benign Het
Serpina11 G T 12: 103,952,233 (GRCm39) T179K probably damaging Het
Serpina1f T C 12: 103,659,655 (GRCm39) N209S possibly damaging Het
Serpinf2 G A 11: 75,327,588 (GRCm39) T159I probably benign Het
Slc19a1 T C 10: 76,877,758 (GRCm39) C98R possibly damaging Het
Slc22a20 A T 19: 6,021,553 (GRCm39) I483N possibly damaging Het
Spata31d1d A G 13: 59,879,435 (GRCm39) C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Timd5 A G 11: 46,419,394 (GRCm39) N70S probably benign Het
Tln1 C T 4: 43,553,083 (GRCm39) probably null Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Tmx3 T C 18: 90,546,037 (GRCm39) F206S probably damaging Het
Tnfsf14 T C 17: 57,497,638 (GRCm39) D198G possibly damaging Het
Trappc10 A G 10: 78,034,876 (GRCm39) probably null Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Ube3b G A 5: 114,527,135 (GRCm39) V118M probably damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Vmn2r53 T A 7: 12,335,366 (GRCm39) Y98F probably damaging Het
Vmn2r58 T A 7: 41,513,594 (GRCm39) N350Y probably benign Het
Vmn2r82 A T 10: 79,192,519 (GRCm39) H32L probably benign Het
Wsb1 T C 11: 79,131,212 (GRCm39) I395V probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfat T C 15: 68,051,709 (GRCm39) D695G probably benign Het
Zfp358 G T 8: 3,546,995 (GRCm39) V526F possibly damaging Het
Zmat1 A G X: 133,873,861 (GRCm39) L476P possibly damaging Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122,163,622 (GRCm39) missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122,153,787 (GRCm39) missense probably benign 0.42
IGL01413:Duox1 APN 2 122,151,191 (GRCm39) missense probably benign 0.03
IGL01444:Duox1 APN 2 122,170,571 (GRCm39) missense probably damaging 0.98
IGL01633:Duox1 APN 2 122,164,279 (GRCm39) missense probably benign 0.00
IGL01814:Duox1 APN 2 122,176,753 (GRCm39) missense probably damaging 0.99
IGL01868:Duox1 APN 2 122,168,888 (GRCm39) missense probably benign
IGL02096:Duox1 APN 2 122,174,655 (GRCm39) missense probably damaging 0.99
IGL02126:Duox1 APN 2 122,176,817 (GRCm39) missense probably benign 0.21
IGL02342:Duox1 APN 2 122,177,793 (GRCm39) missense probably damaging 1.00
IGL02687:Duox1 APN 2 122,166,896 (GRCm39) missense probably damaging 1.00
IGL02708:Duox1 APN 2 122,156,498 (GRCm39) missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122,155,000 (GRCm39) missense possibly damaging 0.56
antiquity UTSW 2 122,170,682 (GRCm39) missense probably damaging 1.00
Dejavous UTSW 2 122,151,345 (GRCm39) missense probably damaging 1.00
R1706_Duox1_051 UTSW 2 122,149,953 (GRCm39) missense probably benign 0.01
R5032_duox1_732 UTSW 2 122,167,798 (GRCm39) missense probably benign
Vaguely UTSW 2 122,156,616 (GRCm39) nonsense probably null
D4043:Duox1 UTSW 2 122,175,276 (GRCm39) missense probably benign
R0047:Duox1 UTSW 2 122,177,122 (GRCm39) unclassified probably benign
R0047:Duox1 UTSW 2 122,177,122 (GRCm39) unclassified probably benign
R0241:Duox1 UTSW 2 122,163,878 (GRCm39) splice site probably benign
R0479:Duox1 UTSW 2 122,176,861 (GRCm39) missense probably damaging 1.00
R0834:Duox1 UTSW 2 122,176,982 (GRCm39) missense probably damaging 1.00
R1105:Duox1 UTSW 2 122,168,183 (GRCm39) missense probably damaging 0.97
R1205:Duox1 UTSW 2 122,158,406 (GRCm39) nonsense probably null
R1281:Duox1 UTSW 2 122,157,569 (GRCm39) missense probably damaging 1.00
R1302:Duox1 UTSW 2 122,177,760 (GRCm39) missense probably benign 0.24
R1532:Duox1 UTSW 2 122,175,204 (GRCm39) missense probably damaging 1.00
R1706:Duox1 UTSW 2 122,149,953 (GRCm39) missense probably benign 0.01
R1719:Duox1 UTSW 2 122,169,125 (GRCm39) missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122,163,910 (GRCm39) missense probably damaging 1.00
R1827:Duox1 UTSW 2 122,177,861 (GRCm39) nonsense probably null
R1828:Duox1 UTSW 2 122,177,861 (GRCm39) nonsense probably null
R1940:Duox1 UTSW 2 122,156,465 (GRCm39) missense probably benign 0.06
R1944:Duox1 UTSW 2 122,177,001 (GRCm39) missense probably damaging 0.99
R2069:Duox1 UTSW 2 122,163,543 (GRCm39) missense probably benign
R2113:Duox1 UTSW 2 122,167,735 (GRCm39) missense probably benign
R2314:Duox1 UTSW 2 122,164,211 (GRCm39) nonsense probably null
R2507:Duox1 UTSW 2 122,163,619 (GRCm39) missense probably benign 0.34
R2508:Duox1 UTSW 2 122,163,619 (GRCm39) missense probably benign 0.34
R3177:Duox1 UTSW 2 122,170,597 (GRCm39) missense probably damaging 1.00
R3277:Duox1 UTSW 2 122,170,597 (GRCm39) missense probably damaging 1.00
R4124:Duox1 UTSW 2 122,167,902 (GRCm39) missense probably damaging 1.00
R4271:Duox1 UTSW 2 122,154,856 (GRCm39) missense probably damaging 0.96
R4411:Duox1 UTSW 2 122,168,115 (GRCm39) missense probably benign 0.30
R4419:Duox1 UTSW 2 122,157,607 (GRCm39) missense probably benign
R4420:Duox1 UTSW 2 122,157,607 (GRCm39) missense probably benign
R4578:Duox1 UTSW 2 122,164,258 (GRCm39) missense probably benign 0.15
R4628:Duox1 UTSW 2 122,176,733 (GRCm39) missense probably damaging 1.00
R4665:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R4666:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R4730:Duox1 UTSW 2 122,164,312 (GRCm39) missense probably damaging 1.00
R4767:Duox1 UTSW 2 122,163,922 (GRCm39) missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122,146,212 (GRCm39) missense probably benign 0.05
R4904:Duox1 UTSW 2 122,151,345 (GRCm39) missense probably damaging 1.00
R5032:Duox1 UTSW 2 122,167,798 (GRCm39) missense probably benign
R5201:Duox1 UTSW 2 122,158,403 (GRCm39) missense probably benign
R5474:Duox1 UTSW 2 122,177,106 (GRCm39) missense probably benign 0.02
R5835:Duox1 UTSW 2 122,158,341 (GRCm39) missense probably benign 0.00
R5939:Duox1 UTSW 2 122,176,832 (GRCm39) missense probably damaging 1.00
R5941:Duox1 UTSW 2 122,174,637 (GRCm39) missense probably damaging 0.97
R5943:Duox1 UTSW 2 122,163,916 (GRCm39) missense probably benign 0.00
R5970:Duox1 UTSW 2 122,170,682 (GRCm39) missense probably damaging 1.00
R6023:Duox1 UTSW 2 122,168,165 (GRCm39) missense probably benign 0.19
R6050:Duox1 UTSW 2 122,149,956 (GRCm39) missense probably benign 0.00
R6064:Duox1 UTSW 2 122,151,243 (GRCm39) missense probably benign 0.00
R6093:Duox1 UTSW 2 122,177,755 (GRCm39) missense probably benign 0.01
R6188:Duox1 UTSW 2 122,150,275 (GRCm39) missense probably benign 0.00
R6246:Duox1 UTSW 2 122,157,655 (GRCm39) missense probably damaging 1.00
R6259:Duox1 UTSW 2 122,175,264 (GRCm39) missense probably benign 0.00
R6290:Duox1 UTSW 2 122,164,288 (GRCm39) missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122,168,181 (GRCm39) missense probably damaging 0.99
R6341:Duox1 UTSW 2 122,168,202 (GRCm39) missense probably damaging 0.98
R6498:Duox1 UTSW 2 122,150,088 (GRCm39) missense probably damaging 1.00
R6883:Duox1 UTSW 2 122,155,065 (GRCm39) splice site probably null
R7002:Duox1 UTSW 2 122,150,358 (GRCm39) nonsense probably null
R7410:Duox1 UTSW 2 122,176,874 (GRCm39) missense probably damaging 1.00
R7421:Duox1 UTSW 2 122,153,711 (GRCm39) missense probably damaging 1.00
R7608:Duox1 UTSW 2 122,156,616 (GRCm39) nonsense probably null
R7702:Duox1 UTSW 2 122,160,120 (GRCm39) missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122,167,782 (GRCm39) missense probably benign
R7833:Duox1 UTSW 2 122,154,869 (GRCm39) missense probably damaging 1.00
R7980:Duox1 UTSW 2 122,177,801 (GRCm39) missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122,175,249 (GRCm39) missense probably benign 0.02
R8717:Duox1 UTSW 2 122,168,152 (GRCm39) missense possibly damaging 0.88
R8992:Duox1 UTSW 2 122,175,186 (GRCm39) missense probably damaging 1.00
R9196:Duox1 UTSW 2 122,150,689 (GRCm39) missense probably benign 0.08
R9344:Duox1 UTSW 2 122,168,163 (GRCm39) missense probably benign 0.14
R9397:Duox1 UTSW 2 122,150,783 (GRCm39) missense possibly damaging 0.48
R9491:Duox1 UTSW 2 122,156,907 (GRCm39) missense probably benign 0.01
R9510:Duox1 UTSW 2 122,160,023 (GRCm39) missense possibly damaging 0.92
R9521:Duox1 UTSW 2 122,159,216 (GRCm39) missense possibly damaging 0.81
R9562:Duox1 UTSW 2 122,151,203 (GRCm39) missense probably damaging 1.00
R9565:Duox1 UTSW 2 122,151,203 (GRCm39) missense probably damaging 1.00
R9569:Duox1 UTSW 2 122,148,971 (GRCm39) missense probably benign
Z1176:Duox1 UTSW 2 122,163,519 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGGAGGAACTTCTGGAGACC -3'
(R):5'- GAACAGCAAGTCTCTGGATTGTG -3'

Sequencing Primer
(F):5'- GAACTTCTGGAGACCATACTGTTGC -3'
(R):5'- CAAGTCTCTGGATTGTGGAAGAG -3'
Posted On 2014-10-02