Mutagenetix > Incidental Mutation

Incidental Mutation 'R2202:Duox1'

238708

Institutional Source

Beutler Lab

Gene Symbol

Duox1

Ensembl Gene

ENSMUSG00000033268

Gene Name

dual oxidase 1

Synonyms

THOX1, LNOX1, 9930101G15Rik, NOXEF1

MMRRC Submission

040204-MU

Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122315672-122347972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122344713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1331 (T1331A)

Ref Sequence

ENSEMBL: ENSMUSP00000097060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]

AlphaFold

A2AQ92

Predicted Effect

probably benign
Transcript: ENSMUST00000048635

SMART Domains

Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	48	67	N/A	INTRINSIC
SH2	136	220	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000099461
AA Change: T1331A

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: T1331A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:An_peroxidase	29	557	2.1e-134	PFAM
transmembrane domain	594	616	N/A	INTRINSIC
EFh	819	847	1.82e-4	SMART
EFh	855	883	3.45e-5	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Ferric_reduct	1087	1236	5.3e-21	PFAM
Pfam:FAD_binding_8	1272	1374	8.5e-21	PFAM
Pfam:NAD_binding_6	1380	1534	3.5e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110530

SMART Domains

Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC
SH2	130	214	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110531

SMART Domains

Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	48	67	N/A	INTRINSIC
SH2	136	220	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110532

SMART Domains

Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	19	38	N/A	INTRINSIC
low complexity region	45	61	N/A	INTRINSIC
low complexity region	77	87	N/A	INTRINSIC
low complexity region	146	165	N/A	INTRINSIC
Blast:SH2	225	278	2e-22	BLAST
SCOP:d1ayaa_	237	291	1e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000121237

SMART Domains

Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	42	61	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125826

SMART Domains

Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	14	56	N/A	INTRINSIC
low complexity region	76	105	N/A	INTRINSIC
low complexity region	129	148	N/A	INTRINSIC
low complexity region	155	171	N/A	INTRINSIC
low complexity region	187	197	N/A	INTRINSIC
low complexity region	256	275	N/A	INTRINSIC
SH2	344	428	9.16e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135848

Predicted Effect

probably benign
Transcript: ENSMUST00000139819

SMART Domains

Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	14	24	N/A	INTRINSIC
low complexity region	83	102	N/A	INTRINSIC
low complexity region	149	163	N/A	INTRINSIC
SH2	218	302	9.16e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143484

SMART Domains

Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	14	33	N/A	INTRINSIC
SH2	71	155	3.19e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151130

SMART Domains

Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

Domain	Start	End	E-Value	Type
low complexity region	6	48	N/A	INTRINSIC
low complexity region	68	97	N/A	INTRINSIC
low complexity region	121	140	N/A	INTRINSIC
low complexity region	147	163	N/A	INTRINSIC
low complexity region	179	189	N/A	INTRINSIC
low complexity region	248	267	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]

Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,898,668	V249A	possibly damaging	Het
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Abca14	T	C	7: 120,289,541	Y1237H	probably benign	Het
Abi3bp	T	G	16: 56,613,203	L550R	probably benign	Het
Abi3bp	C	T	16: 56,650,725	R578*	probably null	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
AI987944	T	C	7: 41,374,526	E343G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Atp1b1	G	T	1: 164,453,515	T11K	probably benign	Het
Calr3	A	G	8: 72,434,839	L40S	probably damaging	Het
Ccar1	A	C	10: 62,745,287	D1119E	unknown	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Cdk12	T	G	11: 98,210,638	S441A	unknown	Het
Ces4a	T	A	8: 105,146,114	V333E	probably damaging	Het
Cfap61	T	C	2: 146,214,680	L1193P	probably damaging	Het
Chd2	A	T	7: 73,478,668	D856E	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cln3	T	A	7: 126,579,218	H211L	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dcstamp	T	A	15: 39,754,312	V39E	probably damaging	Het
Dicer1	C	T	12: 104,731,038	V87M	possibly damaging	Het
Fam184a	T	A	10: 53,652,434	Q29L	probably damaging	Het
Fcer2a	T	C	8: 3,688,557	E60G	possibly damaging	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Fnbp1l	A	T	3: 122,546,962	M463K	probably benign	Het
Garem2	A	G	5: 30,114,764	D408G	probably benign	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Gtf2e1	T	A	16: 37,511,542	E390D	possibly damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Il15ra	T	A	2: 11,718,344		probably null	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Jmjd1c	A	G	10: 67,239,463		probably null	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Letm1	C	A	5: 33,769,486	V156L	possibly damaging	Het
Lrrc24	G	A	15: 76,722,911	P95L	probably damaging	Het
Map2k2	T	C	10: 81,119,379	S14P	probably damaging	Het
Me3	T	C	7: 89,850,381	Y535H	probably damaging	Het
Nfatc2ip	T	C	7: 126,391,295	E178G	probably benign	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr164	C	T	16: 19,286,297	A149T	probably benign	Het
Olfr714	T	A	7: 107,074,316	W163R	probably damaging	Het
Pbrm1	A	G	14: 31,032,449	D142G	possibly damaging	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pid1	T	A	1: 84,038,438	I69F	probably damaging	Het
Pkhd1	A	G	1: 20,537,360	S1091P	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Plxnd1	T	C	6: 115,962,764	N1418S	probably benign	Het
Pmm1	T	C	15: 81,956,400	T82A	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Ptprz1	C	T	6: 23,000,650	T913M	possibly damaging	Het
Ralgapa1	T	C	12: 55,612,800		probably null	Het
Rbm8a2	T	C	1: 175,978,854	E19G	possibly damaging	Het
Rgs3	T	C	4: 62,690,504	S336P	probably damaging	Het
Serpina11	G	T	12: 103,985,974	T179K	probably damaging	Het
Serpina1f	T	C	12: 103,693,396	N209S	possibly damaging	Het
Serpinf2	G	A	11: 75,436,762	T159I	probably benign	Het
Slc19a1	T	C	10: 77,041,924	C98R	possibly damaging	Het
Slc22a20	A	T	19: 5,971,525	I483N	possibly damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Tex45	A	T	8: 3,479,028	D201V	probably benign	Het
Tln1	C	T	4: 43,553,083		probably null	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tmx3	T	C	18: 90,527,913	F206S	probably damaging	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trappc10	A	G	10: 78,199,042		probably null	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r53	T	A	7: 12,601,439	Y98F	probably damaging	Het
Vmn2r58	T	A	7: 41,864,170	N350Y	probably benign	Het
Vmn2r82	A	T	10: 79,356,685	H32L	probably benign	Het
Wsb1	T	C	11: 79,240,386	I395V	probably benign	Het
Zfat	T	C	15: 68,179,860	D695G	probably benign	Het
Zfp358	G	T	8: 3,496,995	V526F	possibly damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het

Other mutations in Duox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Duox1	APN	2	122333141	missense	possibly damaging	0.55
IGL00956:Duox1	APN	2	122323306	missense	probably benign	0.42
IGL01413:Duox1	APN	2	122320710	missense	probably benign	0.03
IGL01444:Duox1	APN	2	122340090	missense	probably damaging	0.98
IGL01633:Duox1	APN	2	122333798	missense	probably benign	0.00
IGL01814:Duox1	APN	2	122346272	missense	probably damaging	0.99
IGL01868:Duox1	APN	2	122338407	missense	probably benign
IGL02096:Duox1	APN	2	122344174	missense	probably damaging	0.99
IGL02126:Duox1	APN	2	122346336	missense	probably benign	0.21
IGL02342:Duox1	APN	2	122347312	missense	probably damaging	1.00
IGL02687:Duox1	APN	2	122336415	missense	probably damaging	1.00
IGL02708:Duox1	APN	2	122326017	missense	possibly damaging	0.81
IGL02935:Duox1	APN	2	122324519	missense	possibly damaging	0.56
antiquity	UTSW	2	122340201	missense	probably damaging	1.00
Dejavous	UTSW	2	122320864	missense	probably damaging	1.00
R1706_Duox1_051	UTSW	2	122319472	missense	probably benign	0.01
R5032_duox1_732	UTSW	2	122337317	missense	probably benign
Vaguely	UTSW	2	122326135	nonsense	probably null
D4043:Duox1	UTSW	2	122344795	missense	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0047:Duox1	UTSW	2	122346641	unclassified	probably benign
R0241:Duox1	UTSW	2	122333397	splice site	probably benign
R0479:Duox1	UTSW	2	122346380	missense	probably damaging	1.00
R0834:Duox1	UTSW	2	122346501	missense	probably damaging	1.00
R1105:Duox1	UTSW	2	122337702	missense	probably damaging	0.97
R1205:Duox1	UTSW	2	122327925	nonsense	probably null
R1281:Duox1	UTSW	2	122327088	missense	probably damaging	1.00
R1302:Duox1	UTSW	2	122347279	missense	probably benign	0.24
R1532:Duox1	UTSW	2	122344723	missense	probably damaging	1.00
R1706:Duox1	UTSW	2	122319472	missense	probably benign	0.01
R1719:Duox1	UTSW	2	122338644	missense	possibly damaging	0.93
R1753:Duox1	UTSW	2	122333429	missense	probably damaging	1.00
R1827:Duox1	UTSW	2	122347380	nonsense	probably null
R1828:Duox1	UTSW	2	122347380	nonsense	probably null
R1940:Duox1	UTSW	2	122325984	missense	probably benign	0.06
R1944:Duox1	UTSW	2	122346520	missense	probably damaging	0.99
R2069:Duox1	UTSW	2	122333062	missense	probably benign
R2113:Duox1	UTSW	2	122337254	missense	probably benign
R2314:Duox1	UTSW	2	122333730	nonsense	probably null
R2507:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R2508:Duox1	UTSW	2	122333138	missense	probably benign	0.34
R3177:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R3277:Duox1	UTSW	2	122340116	missense	probably damaging	1.00
R4124:Duox1	UTSW	2	122337421	missense	probably damaging	1.00
R4271:Duox1	UTSW	2	122324375	missense	probably damaging	0.96
R4411:Duox1	UTSW	2	122337634	missense	probably benign	0.30
R4419:Duox1	UTSW	2	122327126	missense	probably benign
R4420:Duox1	UTSW	2	122327126	missense	probably benign
R4578:Duox1	UTSW	2	122333777	missense	probably benign	0.15
R4628:Duox1	UTSW	2	122346252	missense	probably damaging	1.00
R4665:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4666:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R4730:Duox1	UTSW	2	122333831	missense	probably damaging	1.00
R4767:Duox1	UTSW	2	122333441	missense	possibly damaging	0.79
R4857:Duox1	UTSW	2	122315731	missense	probably benign	0.05
R4904:Duox1	UTSW	2	122320864	missense	probably damaging	1.00
R5032:Duox1	UTSW	2	122337317	missense	probably benign
R5201:Duox1	UTSW	2	122327922	missense	probably benign
R5474:Duox1	UTSW	2	122346625	missense	probably benign	0.02
R5835:Duox1	UTSW	2	122327860	missense	probably benign	0.00
R5939:Duox1	UTSW	2	122346351	missense	probably damaging	1.00
R5941:Duox1	UTSW	2	122344156	missense	probably damaging	0.97
R5943:Duox1	UTSW	2	122333435	missense	probably benign	0.00
R5970:Duox1	UTSW	2	122340201	missense	probably damaging	1.00
R6023:Duox1	UTSW	2	122337684	missense	probably benign	0.19
R6050:Duox1	UTSW	2	122319475	missense	probably benign	0.00
R6064:Duox1	UTSW	2	122320762	missense	probably benign	0.00
R6093:Duox1	UTSW	2	122347274	missense	probably benign	0.01
R6188:Duox1	UTSW	2	122319794	missense	probably benign	0.00
R6246:Duox1	UTSW	2	122327174	missense	probably damaging	1.00
R6259:Duox1	UTSW	2	122344783	missense	probably benign	0.00
R6290:Duox1	UTSW	2	122333807	missense	possibly damaging	0.92
R6300:Duox1	UTSW	2	122337700	missense	probably damaging	0.99
R6341:Duox1	UTSW	2	122337721	missense	probably damaging	0.98
R6498:Duox1	UTSW	2	122319607	missense	probably damaging	1.00
R6883:Duox1	UTSW	2	122324584	splice site	probably null
R7002:Duox1	UTSW	2	122319877	nonsense	probably null
R7410:Duox1	UTSW	2	122346393	missense	probably damaging	1.00
R7421:Duox1	UTSW	2	122323230	missense	probably damaging	1.00
R7608:Duox1	UTSW	2	122326135	nonsense	probably null
R7702:Duox1	UTSW	2	122329639	missense	possibly damaging	0.86
R7766:Duox1	UTSW	2	122337301	missense	probably benign
R7833:Duox1	UTSW	2	122324388	missense	probably damaging	1.00
R7980:Duox1	UTSW	2	122347320	missense	possibly damaging	0.71
R8275:Duox1	UTSW	2	122344768	missense	probably benign	0.02
R8717:Duox1	UTSW	2	122337671	missense	possibly damaging	0.88
R8992:Duox1	UTSW	2	122344705	missense	probably damaging	1.00
R9196:Duox1	UTSW	2	122320208	missense	probably benign	0.08
R9344:Duox1	UTSW	2	122337682	missense	probably benign	0.14
R9397:Duox1	UTSW	2	122320302	missense	possibly damaging	0.48
R9491:Duox1	UTSW	2	122326426	missense	probably benign	0.01
R9510:Duox1	UTSW	2	122329542	missense	possibly damaging	0.92
R9521:Duox1	UTSW	2	122328735	missense	possibly damaging	0.81
R9562:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9565:Duox1	UTSW	2	122320722	missense	probably damaging	1.00
R9569:Duox1	UTSW	2	122318490	missense	probably benign
Z1176:Duox1	UTSW	2	122333038	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTGGAGGAACTTCTGGAGACC -3'
(R):5'- GAACAGCAAGTCTCTGGATTGTG -3'

Sequencing Primer
(F):5'- GAACTTCTGGAGACCATACTGTTGC -3'
(R):5'- CAAGTCTCTGGATTGTGGAAGAG -3'

Posted On

2014-10-02