Mutagenetix > Incidental Mutations

Incidental Mutation 'R2202:Plcb4'

238710

Institutional Source

Beutler Lab

Gene Symbol

Plcb4

Ensembl Gene

ENSMUSG00000039943

Gene Name

phospholipase C, beta 4

Synonyms

A930039J07Rik, C230058B11Rik

MMRRC Submission

040204-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135659011-136014593 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136002594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 144 (I144T)

Ref Sequence

ENSEMBL: ENSMUSP00000117578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000147744] [ENSMUST00000184371]

AlphaFold

Q91UZ1

Predicted Effect

probably benign
Transcript: ENSMUST00000035646
AA Change: I1083T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: I1083T

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	1.1e-26	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	909	955	4.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110109
AA Change: I1083T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: I1083T

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	6.1e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	913	955	1.2e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147122

Predicted Effect

probably benign
Transcript: ENSMUST00000147744
AA Change: I144T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000117578
Gene: ENSMUSG00000039943
AA Change: I144T

Domain	Start	End	E-Value	Type
Pfam:DUF1154	1	16	1.7e-7	PFAM
coiled coil region	187	217	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000184371

SMART Domains

Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	9e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	909	955	4.1e-23	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,898,668	V249A	possibly damaging	Het
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Abca14	T	C	7: 120,289,541	Y1237H	probably benign	Het
Abi3bp	T	G	16: 56,613,203	L550R	probably benign	Het
Abi3bp	C	T	16: 56,650,725	R578*	probably null	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
AI987944	T	C	7: 41,374,526	E343G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Atp1b1	G	T	1: 164,453,515	T11K	probably benign	Het
Calr3	A	G	8: 72,434,839	L40S	probably damaging	Het
Ccar1	A	C	10: 62,745,287	D1119E	unknown	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Cdk12	T	G	11: 98,210,638	S441A	unknown	Het
Ces4a	T	A	8: 105,146,114	V333E	probably damaging	Het
Cfap61	T	C	2: 146,214,680	L1193P	probably damaging	Het
Chd2	A	T	7: 73,478,668	D856E	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cln3	T	A	7: 126,579,218	H211L	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dcstamp	T	A	15: 39,754,312	V39E	probably damaging	Het
Dicer1	C	T	12: 104,731,038	V87M	probably damaging	Het
Duox1	A	G	2: 122,344,713	T1331A	probably benign	Het
Fam184a	T	A	10: 53,652,434	Q29L	probably damaging	Het
Fcer2a	T	C	8: 3,688,557	E60G	possibly damaging	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Fnbp1l	A	T	3: 122,546,962	M463K	probably benign	Het
Garem2	A	G	5: 30,114,764	D408G	probably benign	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Gtf2e1	T	A	16: 37,511,542	E390D	possibly damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Il15ra	T	A	2: 11,718,344		probably null	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Jmjd1c	A	G	10: 67,239,463		probably null	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Letm1	C	A	5: 33,769,486	V156L	possibly damaging	Het
Lrrc24	G	A	15: 76,722,911	P95L	probably damaging	Het
Map2k2	T	C	10: 81,119,379	S14P	probably damaging	Het
Me3	T	C	7: 89,850,381	Y535H	probably damaging	Het
Nfatc2ip	T	C	7: 126,391,295	E178G	probably benign	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr164	C	T	16: 19,286,297	A149T	probably benign	Het
Olfr714	T	A	7: 107,074,316	W163R	probably damaging	Het
Pbrm1	A	G	14: 31,032,449	D142G	possibly damaging	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pid1	T	A	1: 84,038,438	I69F	probably damaging	Het
Pkhd1	A	G	1: 20,537,360	S1091P	probably benign	Het
Plxnd1	T	C	6: 115,962,764	N1418S	probably benign	Het
Pmm1	T	C	15: 81,956,400	T82A	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Ptprz1	C	T	6: 23,000,650	T913M	possibly damaging	Het
Ralgapa1	T	C	12: 55,612,800		probably null	Het
Rbm8a2	T	C	1: 175,978,854	E19G	possibly damaging	Het
Rgs3	T	C	4: 62,690,504	S336P	probably damaging	Het
Serpina11	G	T	12: 103,985,974	T179K	probably damaging	Het
Serpina1f	T	C	12: 103,693,396	N209S	possibly damaging	Het
Serpinf2	G	A	11: 75,436,762	T159I	probably benign	Het
Slc19a1	T	C	10: 77,041,924	C98R	possibly damaging	Het
Slc22a20	A	T	19: 5,971,525	I483N	possibly damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Tex45	A	T	8: 3,479,028	D201V	probably benign	Het
Tln1	C	T	4: 43,553,083		probably null	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tmx3	T	C	18: 90,527,913	F206S	probably damaging	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trappc10	A	G	10: 78,199,042		probably null	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r53	T	A	7: 12,601,439	Y98F	probably damaging	Het
Vmn2r58	T	A	7: 41,864,170	N350Y	probably benign	Het
Vmn2r82	A	T	10: 79,356,685	H32L	probably benign	Het
Wsb1	T	C	11: 79,240,386	I395V	probably benign	Het
Zfat	T	C	15: 68,179,860	D695G	probably benign	Het
Zfp358	G	T	8: 3,496,995	V526F	possibly damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het

Other mutations in Plcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Plcb4	APN	2	135971798	missense	probably benign	0.26
IGL01405:Plcb4	APN	2	135950347	missense	probably damaging	1.00
IGL01522:Plcb4	APN	2	136002627	missense	probably damaging	1.00
IGL01589:Plcb4	APN	2	135967118	missense	probably benign
IGL02090:Plcb4	APN	2	135947121	missense	probably benign	0.00
IGL02247:Plcb4	APN	2	135994325	missense	possibly damaging	0.95
IGL02259:Plcb4	APN	2	135910246	critical splice donor site	probably null
IGL02338:Plcb4	APN	2	136000180	missense	possibly damaging	0.87
IGL02625:Plcb4	APN	2	135961794	missense	probably benign	0.19
IGL03026:Plcb4	APN	2	135950429	splice site	probably benign
IGL03111:Plcb4	APN	2	135976282	missense	probably damaging	1.00
R0044:Plcb4	UTSW	2	135971856	missense	probably damaging	1.00
R0066:Plcb4	UTSW	2	135961769	missense	probably benign	0.10
R0066:Plcb4	UTSW	2	135961769	missense	probably benign	0.10
R0143:Plcb4	UTSW	2	135976211	missense	probably damaging	1.00
R0234:Plcb4	UTSW	2	135982075	missense	probably benign	0.00
R0234:Plcb4	UTSW	2	135982075	missense	probably benign	0.00
R0348:Plcb4	UTSW	2	135968419	missense	probably damaging	1.00
R0557:Plcb4	UTSW	2	135954349	missense	probably damaging	0.99
R0591:Plcb4	UTSW	2	135955012	splice site	probably benign
R0975:Plcb4	UTSW	2	135987912	splice site	probably benign
R1187:Plcb4	UTSW	2	135968394	missense	probably benign	0.36
R1235:Plcb4	UTSW	2	135972948	missense	probably damaging	1.00
R1445:Plcb4	UTSW	2	136000189	missense	possibly damaging	0.90
R1562:Plcb4	UTSW	2	135970447	critical splice donor site	probably null
R1594:Plcb4	UTSW	2	135970390	splice site	probably benign
R1920:Plcb4	UTSW	2	136013027	missense	probably damaging	1.00
R2041:Plcb4	UTSW	2	135938271	missense	probably damaging	1.00
R2141:Plcb4	UTSW	2	135976099	missense	probably damaging	1.00
R2142:Plcb4	UTSW	2	135976099	missense	probably damaging	1.00
R2203:Plcb4	UTSW	2	136002594	missense	probably benign	0.01
R2204:Plcb4	UTSW	2	136002594	missense	probably benign	0.01
R2250:Plcb4	UTSW	2	135971861	critical splice donor site	probably null
R2291:Plcb4	UTSW	2	135939983	missense	probably benign	0.08
R2326:Plcb4	UTSW	2	135939973	missense	probably damaging	0.99
R2442:Plcb4	UTSW	2	135950382	missense	probably damaging	1.00
R2939:Plcb4	UTSW	2	135939203	splice site	probably benign
R3774:Plcb4	UTSW	2	135958145	missense	probably benign	0.00
R3875:Plcb4	UTSW	2	136002632	missense	probably damaging	0.99
R4594:Plcb4	UTSW	2	136002599	missense	probably damaging	0.98
R4673:Plcb4	UTSW	2	135932271	missense	possibly damaging	0.68
R4812:Plcb4	UTSW	2	136007881	missense	probably damaging	1.00
R5084:Plcb4	UTSW	2	136002651	missense	probably damaging	1.00
R5468:Plcb4	UTSW	2	135967152	missense	probably damaging	1.00
R5498:Plcb4	UTSW	2	135976172	missense	probably damaging	1.00
R5923:Plcb4	UTSW	2	135961814	nonsense	probably null
R6241:Plcb4	UTSW	2	135910174	missense	possibly damaging	0.80
R6492:Plcb4	UTSW	2	135973071	nonsense	probably null
R6514:Plcb4	UTSW	2	135954996	missense	probably benign	0.22
R6570:Plcb4	UTSW	2	135982986	missense	probably benign	0.13
R6721:Plcb4	UTSW	2	135910237	missense	probably benign	0.01
R6915:Plcb4	UTSW	2	135947115	missense	possibly damaging	0.84
R6991:Plcb4	UTSW	2	135910194	missense	probably damaging	1.00
R7040:Plcb4	UTSW	2	135932262	missense	probably benign
R7086:Plcb4	UTSW	2	136007847	missense	probably benign
R7114:Plcb4	UTSW	2	135982123	critical splice donor site	probably null
R7249:Plcb4	UTSW	2	136007821	critical splice acceptor site	probably null
R7264:Plcb4	UTSW	2	135965080	missense	probably benign
R7361:Plcb4	UTSW	2	135976148	missense	possibly damaging	0.82
R7426:Plcb4	UTSW	2	136000219	missense	probably benign	0.00
R7429:Plcb4	UTSW	2	135968322	missense	probably damaging	1.00
R7430:Plcb4	UTSW	2	135968322	missense	probably damaging	1.00
R8010:Plcb4	UTSW	2	135907560	missense	probably benign	0.00
R8141:Plcb4	UTSW	2	135939249	missense	probably damaging	1.00
R9072:Plcb4	UTSW	2	136007875	missense	possibly damaging	0.93
R9119:Plcb4	UTSW	2	135967952	missense	probably damaging	1.00
R9287:Plcb4	UTSW	2	135987897	missense	probably benign	0.00
R9448:Plcb4	UTSW	2	135910125	missense	possibly damaging	0.47
Z1177:Plcb4	UTSW	2	135958738	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AAGGCACCCTTTAGGAGTGTG -3'
(R):5'- GTACTAACAGGACTCTTCGAACACC -3'

Sequencing Primer
(F):5'- CCCTTTAGGAGTGTGGCACAAAG -3'
(R):5'- CGAACACCACAGTATTAATATCTCAG -3'

Posted On

2014-10-02