Mutagenetix > Incidental Mutation

Incidental Mutation 'R2202:Ube3b'

238730

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

040204-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2202 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114389074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 118 (V118M)

Ref Sequence

ENSEMBL: ENSMUSP00000138723 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169] [ENSMUST00000151809]

AlphaFold

Q9ES34

Predicted Effect

probably damaging
Transcript: ENSMUST00000074002
AA Change: V118M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: V118M

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130169
AA Change: V118M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577
AA Change: V118M

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151809

SMART Domains

Protein: ENSMUSP00000142943
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	5.6e-5	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,898,668	V249A	possibly damaging	Het
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Abca14	T	C	7: 120,289,541	Y1237H	probably benign	Het
Abi3bp	T	G	16: 56,613,203	L550R	probably benign	Het
Abi3bp	C	T	16: 56,650,725	R578*	probably null	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
AI987944	T	C	7: 41,374,526	E343G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Atp1b1	G	T	1: 164,453,515	T11K	probably benign	Het
Calr3	A	G	8: 72,434,839	L40S	probably damaging	Het
Ccar1	A	C	10: 62,745,287	D1119E	unknown	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Cdk12	T	G	11: 98,210,638	S441A	unknown	Het
Ces4a	T	A	8: 105,146,114	V333E	probably damaging	Het
Cfap61	T	C	2: 146,214,680	L1193P	probably damaging	Het
Chd2	A	T	7: 73,478,668	D856E	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cln3	T	A	7: 126,579,218	H211L	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dcstamp	T	A	15: 39,754,312	V39E	probably damaging	Het
Dicer1	C	T	12: 104,731,038	V87M	possibly damaging	Het
Duox1	A	G	2: 122,344,713	T1331A	probably benign	Het
Fam184a	T	A	10: 53,652,434	Q29L	probably damaging	Het
Fcer2a	T	C	8: 3,688,557	E60G	possibly damaging	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Fnbp1l	A	T	3: 122,546,962	M463K	probably benign	Het
Garem2	A	G	5: 30,114,764	D408G	probably benign	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Gtf2e1	T	A	16: 37,511,542	E390D	possibly damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Il15ra	T	A	2: 11,718,344		probably null	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Jmjd1c	A	G	10: 67,239,463		probably null	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Letm1	C	A	5: 33,769,486	V156L	possibly damaging	Het
Lrrc24	G	A	15: 76,722,911	P95L	probably damaging	Het
Map2k2	T	C	10: 81,119,379	S14P	probably damaging	Het
Me3	T	C	7: 89,850,381	Y535H	probably damaging	Het
Nfatc2ip	T	C	7: 126,391,295	E178G	probably benign	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr164	C	T	16: 19,286,297	A149T	probably benign	Het
Olfr714	T	A	7: 107,074,316	W163R	probably damaging	Het
Pbrm1	A	G	14: 31,032,449	D142G	possibly damaging	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pid1	T	A	1: 84,038,438	I69F	probably damaging	Het
Pkhd1	A	G	1: 20,537,360	S1091P	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Plxnd1	T	C	6: 115,962,764	N1418S	probably benign	Het
Pmm1	T	C	15: 81,956,400	T82A	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Ptprz1	C	T	6: 23,000,650	T913M	possibly damaging	Het
Ralgapa1	T	C	12: 55,612,800		probably null	Het
Rbm8a2	T	C	1: 175,978,854	E19G	possibly damaging	Het
Rgs3	T	C	4: 62,690,504	S336P	probably damaging	Het
Serpina11	G	T	12: 103,985,974	T179K	probably damaging	Het
Serpina1f	T	C	12: 103,693,396	N209S	possibly damaging	Het
Serpinf2	G	A	11: 75,436,762	T159I	probably benign	Het
Slc19a1	T	C	10: 77,041,924	C98R	possibly damaging	Het
Slc22a20	A	T	19: 5,971,525	I483N	possibly damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Tex45	A	T	8: 3,479,028	D201V	probably benign	Het
Tln1	C	T	4: 43,553,083		probably null	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tmx3	T	C	18: 90,527,913	F206S	probably damaging	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trappc10	A	G	10: 78,199,042		probably null	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r53	T	A	7: 12,601,439	Y98F	probably damaging	Het
Vmn2r58	T	A	7: 41,864,170	N350Y	probably benign	Het
Vmn2r82	A	T	10: 79,356,685	H32L	probably benign	Het
Wsb1	T	C	11: 79,240,386	I395V	probably benign	Het
Zfat	T	C	15: 68,179,860	D695G	probably benign	Het
Zfp358	G	T	8: 3,496,995	V526F	possibly damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GTTGGGTAGATGGACAACGC -3'
(R):5'- AGTCCTCTCCTGGCTAGTAGAC -3'

Sequencing Primer
(F):5'- AGATGGACAACGCCTCGTCTTC -3'
(R):5'- TGGCTAGTAGACCCCCGAAG -3'

Posted On

2014-10-02