Mutagenetix > Incidental Mutation

Incidental Mutation 'R2202:Plxnd1'

238739

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

040204-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115962764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1418 (N1418S)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: N1418S

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: N1418S

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203628

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,898,668	V249A	possibly damaging	Het
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Abca14	T	C	7: 120,289,541	Y1237H	probably benign	Het
Abi3bp	T	G	16: 56,613,203	L550R	probably benign	Het
Abi3bp	C	T	16: 56,650,725	R578*	probably null	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
AI987944	T	C	7: 41,374,526	E343G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Atp1b1	G	T	1: 164,453,515	T11K	probably benign	Het
Calr3	A	G	8: 72,434,839	L40S	probably damaging	Het
Ccar1	A	C	10: 62,745,287	D1119E	unknown	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Cdk12	T	G	11: 98,210,638	S441A	unknown	Het
Ces4a	T	A	8: 105,146,114	V333E	probably damaging	Het
Cfap61	T	C	2: 146,214,680	L1193P	probably damaging	Het
Chd2	A	T	7: 73,478,668	D856E	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cln3	T	A	7: 126,579,218	H211L	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dcstamp	T	A	15: 39,754,312	V39E	probably damaging	Het
Dicer1	C	T	12: 104,731,038	V87M	possibly damaging	Het
Duox1	A	G	2: 122,344,713	T1331A	probably benign	Het
Fam184a	T	A	10: 53,652,434	Q29L	probably damaging	Het
Fcer2a	T	C	8: 3,688,557	E60G	possibly damaging	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Fnbp1l	A	T	3: 122,546,962	M463K	probably benign	Het
Garem2	A	G	5: 30,114,764	D408G	probably benign	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Gtf2e1	T	A	16: 37,511,542	E390D	possibly damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Il15ra	T	A	2: 11,718,344		probably null	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Jmjd1c	A	G	10: 67,239,463		probably null	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Letm1	C	A	5: 33,769,486	V156L	possibly damaging	Het
Lrrc24	G	A	15: 76,722,911	P95L	probably damaging	Het
Map2k2	T	C	10: 81,119,379	S14P	probably damaging	Het
Me3	T	C	7: 89,850,381	Y535H	probably damaging	Het
Nfatc2ip	T	C	7: 126,391,295	E178G	probably benign	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr164	C	T	16: 19,286,297	A149T	probably benign	Het
Olfr714	T	A	7: 107,074,316	W163R	probably damaging	Het
Pbrm1	A	G	14: 31,032,449	D142G	possibly damaging	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pid1	T	A	1: 84,038,438	I69F	probably damaging	Het
Pkhd1	A	G	1: 20,537,360	S1091P	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Pmm1	T	C	15: 81,956,400	T82A	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Ptprz1	C	T	6: 23,000,650	T913M	possibly damaging	Het
Ralgapa1	T	C	12: 55,612,800		probably null	Het
Rbm8a2	T	C	1: 175,978,854	E19G	possibly damaging	Het
Rgs3	T	C	4: 62,690,504	S336P	probably damaging	Het
Serpina11	G	T	12: 103,985,974	T179K	probably damaging	Het
Serpina1f	T	C	12: 103,693,396	N209S	possibly damaging	Het
Serpinf2	G	A	11: 75,436,762	T159I	probably benign	Het
Slc19a1	T	C	10: 77,041,924	C98R	possibly damaging	Het
Slc22a20	A	T	19: 5,971,525	I483N	possibly damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Tex45	A	T	8: 3,479,028	D201V	probably benign	Het
Tln1	C	T	4: 43,553,083		probably null	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tmx3	T	C	18: 90,527,913	F206S	probably damaging	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trappc10	A	G	10: 78,199,042		probably null	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r53	T	A	7: 12,601,439	Y98F	probably damaging	Het
Vmn2r58	T	A	7: 41,864,170	N350Y	probably benign	Het
Vmn2r82	A	T	10: 79,356,685	H32L	probably benign	Het
Wsb1	T	C	11: 79,240,386	I395V	probably benign	Het
Zfat	T	C	15: 68,179,860	D695G	probably benign	Het
Zfp358	G	T	8: 3,496,995	V526F	possibly damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115957565	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CACGCACAGTGTCAGCAAAG -3'
(R):5'- TGACTCTTCAGTAGGAGAGGTTAAGG -3'

Sequencing Primer
(F):5'- AAAGCTGAGCATCCCCCTGG -3'
(R):5'- GGGGGACACTTTGTGGCAG -3'

Posted On

2014-10-02