Incidental Mutation 'R2202:Vmn2r53'
ID 238741
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 040204-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R2202 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 12315397-12342583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 12335366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 98 (Y98F)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118665
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: Y98F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: Y98F

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 64,056,011 (GRCm39) V249A possibly damaging Het
9930111J21Rik2 C G 11: 48,910,149 (GRCm39) L761F probably damaging Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Abca14 T C 7: 119,888,764 (GRCm39) Y1237H probably benign Het
Abi3bp C T 16: 56,471,088 (GRCm39) R578* probably null Het
Abi3bp T G 16: 56,433,566 (GRCm39) L550R probably benign Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ahdc1 A G 4: 132,793,220 (GRCm39) E1487G possibly damaging Het
AI987944 T C 7: 41,023,950 (GRCm39) E343G probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Atp1b1 G T 1: 164,281,084 (GRCm39) T11K probably benign Het
Calr3 A G 8: 73,188,683 (GRCm39) L40S probably damaging Het
Ccar1 A C 10: 62,581,066 (GRCm39) D1119E unknown Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Cdk12 T G 11: 98,101,464 (GRCm39) S441A unknown Het
Ces4a T A 8: 105,872,746 (GRCm39) V333E probably damaging Het
Cfap61 T C 2: 146,056,600 (GRCm39) L1193P probably damaging Het
Chd2 A T 7: 73,128,416 (GRCm39) D856E probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Cln3 T A 7: 126,178,390 (GRCm39) H211L probably benign Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Dcstamp T A 15: 39,617,708 (GRCm39) V39E probably damaging Het
Dicer1 C T 12: 104,697,297 (GRCm39) V87M possibly damaging Het
Duox1 A G 2: 122,175,194 (GRCm39) T1331A probably benign Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Fam184a T A 10: 53,528,530 (GRCm39) Q29L probably damaging Het
Fcer2a T C 8: 3,738,557 (GRCm39) E60G possibly damaging Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Fnbp1l A T 3: 122,340,611 (GRCm39) M463K probably benign Het
Garem2 A G 5: 30,319,762 (GRCm39) D408G probably benign Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Gpc3 T A X: 51,486,083 (GRCm39) I344F probably damaging Het
Gtf2e1 T A 16: 37,331,904 (GRCm39) E390D possibly damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Il15ra T A 2: 11,723,155 (GRCm39) probably null Het
Ints8 A T 4: 11,225,712 (GRCm39) M615K possibly damaging Het
Irak1 G A X: 73,060,744 (GRCm39) T193I probably damaging Het
Jmjd1c A G 10: 67,075,242 (GRCm39) probably null Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Letm1 C A 5: 33,926,830 (GRCm39) V156L possibly damaging Het
Lrrc24 G A 15: 76,607,111 (GRCm39) P95L probably damaging Het
Map2k2 T C 10: 80,955,213 (GRCm39) S14P probably damaging Het
Me3 T C 7: 89,499,589 (GRCm39) Y535H probably damaging Het
Nfatc2ip T C 7: 125,990,467 (GRCm39) E178G probably benign Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10a2 T A 7: 106,673,523 (GRCm39) W163R probably damaging Het
Or2m12 C T 16: 19,105,047 (GRCm39) A149T probably benign Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Pbrm1 A G 14: 30,754,406 (GRCm39) D142G possibly damaging Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pid1 T A 1: 84,016,159 (GRCm39) I69F probably damaging Het
Pkhd1 A G 1: 20,607,584 (GRCm39) S1091P probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Plxnd1 T C 6: 115,939,725 (GRCm39) N1418S probably benign Het
Pmm1 T C 15: 81,840,601 (GRCm39) T82A probably benign Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,649 (GRCm39) T913M possibly damaging Het
Ralgapa1 T C 12: 55,659,585 (GRCm39) probably null Het
Rbm8a2 T C 1: 175,806,420 (GRCm39) E19G possibly damaging Het
Rgs3 T C 4: 62,608,741 (GRCm39) S336P probably damaging Het
Saxo5 A T 8: 3,529,028 (GRCm39) D201V probably benign Het
Serpina11 G T 12: 103,952,233 (GRCm39) T179K probably damaging Het
Serpina1f T C 12: 103,659,655 (GRCm39) N209S possibly damaging Het
Serpinf2 G A 11: 75,327,588 (GRCm39) T159I probably benign Het
Slc19a1 T C 10: 76,877,758 (GRCm39) C98R possibly damaging Het
Slc22a20 A T 19: 6,021,553 (GRCm39) I483N possibly damaging Het
Spata31d1d A G 13: 59,879,435 (GRCm39) C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Timd5 A G 11: 46,419,394 (GRCm39) N70S probably benign Het
Tln1 C T 4: 43,553,083 (GRCm39) probably null Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Tmx3 T C 18: 90,546,037 (GRCm39) F206S probably damaging Het
Tnfsf14 T C 17: 57,497,638 (GRCm39) D198G possibly damaging Het
Trappc10 A G 10: 78,034,876 (GRCm39) probably null Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Ube3b G A 5: 114,527,135 (GRCm39) V118M probably damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Vmn2r58 T A 7: 41,513,594 (GRCm39) N350Y probably benign Het
Vmn2r82 A T 10: 79,192,519 (GRCm39) H32L probably benign Het
Wsb1 T C 11: 79,131,212 (GRCm39) I395V probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfat T C 15: 68,051,709 (GRCm39) D695G probably benign Het
Zfp358 G T 8: 3,546,995 (GRCm39) V526F possibly damaging Het
Zmat1 A G X: 133,873,861 (GRCm39) L476P possibly damaging Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12,334,835 (GRCm39) missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12,316,373 (GRCm39) missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12,315,656 (GRCm39) missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12,316,288 (GRCm39) missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12,315,872 (GRCm39) missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12,315,393 (GRCm39) unclassified probably benign
IGL03064:Vmn2r53 APN 7 12,334,937 (GRCm39) missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12,334,791 (GRCm39) missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12,340,435 (GRCm39) missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12,340,318 (GRCm39) missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12,315,819 (GRCm39) missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12,332,349 (GRCm39) missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12,315,993 (GRCm39) missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12,316,338 (GRCm39) missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12,315,707 (GRCm39) missense probably benign
R0881:Vmn2r53 UTSW 7 12,334,859 (GRCm39) missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12,335,141 (GRCm39) missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12,315,429 (GRCm39) missense probably benign
R1102:Vmn2r53 UTSW 7 12,332,410 (GRCm39) missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12,334,673 (GRCm39) missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12,315,533 (GRCm39) missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12,318,701 (GRCm39) missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12,315,632 (GRCm39) missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12,334,812 (GRCm39) missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12,332,438 (GRCm39) missense possibly damaging 0.76
R3707:Vmn2r53 UTSW 7 12,315,981 (GRCm39) missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12,315,656 (GRCm39) missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12,316,229 (GRCm39) missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12,315,932 (GRCm39) missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12,334,901 (GRCm39) missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4710:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4774:Vmn2r53 UTSW 7 12,334,692 (GRCm39) nonsense probably null
R4859:Vmn2r53 UTSW 7 12,335,330 (GRCm39) missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12,315,741 (GRCm39) missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12,335,347 (GRCm39) missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12,334,733 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12,316,328 (GRCm39) missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12,315,808 (GRCm39) missense probably benign
R6312:Vmn2r53 UTSW 7 12,332,566 (GRCm39) critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12,315,633 (GRCm39) missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12,335,360 (GRCm39) missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12,340,441 (GRCm39) missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12,335,069 (GRCm39) missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12,316,343 (GRCm39) missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12,315,513 (GRCm39) nonsense probably null
R7174:Vmn2r53 UTSW 7 12,315,628 (GRCm39) missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12,334,983 (GRCm39) missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12,340,359 (GRCm39) missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12,315,846 (GRCm39) missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12,332,425 (GRCm39) missense probably benign 0.04
R7714:Vmn2r53 UTSW 7 12,340,418 (GRCm39) missense probably damaging 1.00
R7843:Vmn2r53 UTSW 7 12,316,026 (GRCm39) missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12,335,322 (GRCm39) missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12,315,843 (GRCm39) missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12,340,281 (GRCm39) missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12,315,737 (GRCm39) missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12,334,752 (GRCm39) missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12,315,926 (GRCm39) missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12,315,435 (GRCm39) missense probably benign
R9076:Vmn2r53 UTSW 7 12,340,231 (GRCm39) missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12,335,124 (GRCm39) missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12,315,912 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12,335,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGTGTGGCCAGAGAG -3'
(R):5'- CAGGCGAATCTTTATGTTTCAGAG -3'

Sequencing Primer
(F):5'- AGAGAGCTGGCCTGCTG -3'
(R):5'- TACAGGTAGTTGTGAGCCACC -3'
Posted On 2014-10-02