Mutagenetix > Incidental Mutation

Incidental Mutation 'R2202:Calr3'

238753

Institutional Source

Beutler Lab

Gene Symbol

Calr3

Ensembl Gene

ENSMUSG00000019732

Gene Name

calreticulin 3

Synonyms

Crt2, 6330586I20Rik, calsperin, 1700031L01Rik

MMRRC Submission

040204-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R2202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72424176-72443870 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72434839 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 40 (L40S)

Ref Sequence

ENSEMBL: ENSMUSP00000105601 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019876] [ENSMUST00000109974]

AlphaFold

Q9D9Q6

Predicted Effect

probably damaging
Transcript: ENSMUST00000019876
AA Change: L148S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019876
Gene: ENSMUSG00000019732
AA Change: L148S

Domain	Start	End	E-Value	Type
Pfam:Calreticulin	23	256	5.7e-40	PFAM
Pfam:Calreticulin	255	315	6.6e-7	PFAM
low complexity region	345	359	N/A	INTRINSIC
low complexity region	365	376	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109974
AA Change: L40S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105601
Gene: ENSMUSG00000019732
AA Change: L40S

Domain	Start	End	E-Value	Type
Pfam:Calreticulin	23	207	7.9e-32	PFAM
low complexity region	237	251	N/A	INTRINSIC
low complexity region	257	268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120752

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona pellucida binding and fertilization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,898,668	V249A	possibly damaging	Het
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Abca14	T	C	7: 120,289,541	Y1237H	probably benign	Het
Abi3bp	T	G	16: 56,613,203	L550R	probably benign	Het
Abi3bp	C	T	16: 56,650,725	R578*	probably null	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
AI987944	T	C	7: 41,374,526	E343G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Atp1b1	G	T	1: 164,453,515	T11K	probably benign	Het
Ccar1	A	C	10: 62,745,287	D1119E	unknown	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Cdk12	T	G	11: 98,210,638	S441A	unknown	Het
Ces4a	T	A	8: 105,146,114	V333E	probably damaging	Het
Cfap61	T	C	2: 146,214,680	L1193P	probably damaging	Het
Chd2	A	T	7: 73,478,668	D856E	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cln3	T	A	7: 126,579,218	H211L	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dcstamp	T	A	15: 39,754,312	V39E	probably damaging	Het
Dicer1	C	T	12: 104,731,038	V87M	possibly damaging	Het
Duox1	A	G	2: 122,344,713	T1331A	probably benign	Het
Fam184a	T	A	10: 53,652,434	Q29L	probably damaging	Het
Fcer2a	T	C	8: 3,688,557	E60G	possibly damaging	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Fnbp1l	A	T	3: 122,546,962	M463K	probably benign	Het
Garem2	A	G	5: 30,114,764	D408G	probably benign	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Gtf2e1	T	A	16: 37,511,542	E390D	possibly damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Il15ra	T	A	2: 11,718,344		probably null	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Jmjd1c	A	G	10: 67,239,463		probably null	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Letm1	C	A	5: 33,769,486	V156L	possibly damaging	Het
Lrrc24	G	A	15: 76,722,911	P95L	probably damaging	Het
Map2k2	T	C	10: 81,119,379	S14P	probably damaging	Het
Me3	T	C	7: 89,850,381	Y535H	probably damaging	Het
Nfatc2ip	T	C	7: 126,391,295	E178G	probably benign	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr164	C	T	16: 19,286,297	A149T	probably benign	Het
Olfr714	T	A	7: 107,074,316	W163R	probably damaging	Het
Pbrm1	A	G	14: 31,032,449	D142G	possibly damaging	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pid1	T	A	1: 84,038,438	I69F	probably damaging	Het
Pkhd1	A	G	1: 20,537,360	S1091P	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Plxnd1	T	C	6: 115,962,764	N1418S	probably benign	Het
Pmm1	T	C	15: 81,956,400	T82A	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Ptprz1	C	T	6: 23,000,650	T913M	possibly damaging	Het
Ralgapa1	T	C	12: 55,612,800		probably null	Het
Rbm8a2	T	C	1: 175,978,854	E19G	possibly damaging	Het
Rgs3	T	C	4: 62,690,504	S336P	probably damaging	Het
Serpina11	G	T	12: 103,985,974	T179K	probably damaging	Het
Serpina1f	T	C	12: 103,693,396	N209S	possibly damaging	Het
Serpinf2	G	A	11: 75,436,762	T159I	probably benign	Het
Slc19a1	T	C	10: 77,041,924	C98R	possibly damaging	Het
Slc22a20	A	T	19: 5,971,525	I483N	possibly damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Tex45	A	T	8: 3,479,028	D201V	probably benign	Het
Tln1	C	T	4: 43,553,083		probably null	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tmx3	T	C	18: 90,527,913	F206S	probably damaging	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trappc10	A	G	10: 78,199,042		probably null	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r53	T	A	7: 12,601,439	Y98F	probably damaging	Het
Vmn2r58	T	A	7: 41,864,170	N350Y	probably benign	Het
Vmn2r82	A	T	10: 79,356,685	H32L	probably benign	Het
Wsb1	T	C	11: 79,240,386	I395V	probably benign	Het
Zfat	T	C	15: 68,179,860	D695G	probably benign	Het
Zfp358	G	T	8: 3,496,995	V526F	possibly damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het

Other mutations in Calr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Calr3	APN	8	72431396	nonsense	probably null
IGL01358:Calr3	APN	8	72427213	nonsense	probably null
IGL02440:Calr3	APN	8	72431432	missense	probably benign	0.30
IGL02646:Calr3	APN	8	72443460	missense	possibly damaging	0.89
IGL02882:Calr3	APN	8	72434821	missense	probably damaging	0.99
IGL02945:Calr3	APN	8	72438557	missense	probably damaging	1.00
IGL03025:Calr3	APN	8	72434891	splice site	probably benign
IGL03175:Calr3	APN	8	72443605	missense	probably damaging	1.00
R0140:Calr3	UTSW	8	72434888	splice site	probably benign
R1518:Calr3	UTSW	8	72427200	missense	probably damaging	0.97
R1675:Calr3	UTSW	8	72431458	missense	probably damaging	1.00
R2006:Calr3	UTSW	8	72434851	missense	probably damaging	1.00
R2111:Calr3	UTSW	8	72427268	missense	probably damaging	0.99
R2296:Calr3	UTSW	8	72424625	unclassified	probably benign
R2432:Calr3	UTSW	8	72438426	unclassified	probably benign
R3946:Calr3	UTSW	8	72443620	missense	probably damaging	1.00
R4382:Calr3	UTSW	8	72428164	missense	probably damaging	1.00
R4383:Calr3	UTSW	8	72428164	missense	probably damaging	1.00
R4384:Calr3	UTSW	8	72428164	missense	probably damaging	1.00
R4385:Calr3	UTSW	8	72428164	missense	probably damaging	1.00
R4943:Calr3	UTSW	8	72431377	missense	probably benign	0.18
R5132:Calr3	UTSW	8	72431368	splice site	probably null
R7337:Calr3	UTSW	8	72431495	missense	probably damaging	1.00
R7879:Calr3	UTSW	8	72424643	missense	unknown
R8132:Calr3	UTSW	8	72427179	missense	probably damaging	1.00
R8703:Calr3	UTSW	8	72438447	missense	probably damaging	1.00
R9064:Calr3	UTSW	8	72434830	missense	possibly damaging	0.72
R9314:Calr3	UTSW	8	72424691	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GATGGAGGAAGGGATGAGGC -3'
(R):5'- CTGTTGTGGGAGTCTGACACG -3'

Sequencing Primer
(F):5'- TGAGGCAGGCAGAGAGATG -3'
(R):5'- GTCTTCTGGTGAACTCAAGAGCAC -3'

Posted On

2014-10-02