Mutagenetix > Incidental Mutation

Incidental Mutation 'R2202:Trappc10'

238763

Institutional Source

Beutler Lab

Gene Symbol

Trappc10

Ensembl Gene

ENSMUSG00000000374

Gene Name

trafficking protein particle complex 10

Synonyms

Tmem1, LOC380642, B230307C21Rik

MMRRC Submission

040204-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2202 (G1)

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

78186725-78244641 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 78199042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000000384 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000384]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000000384

SMART Domains

Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374

Domain	Start	End	E-Value	Type
Pfam:TRAPPC10	1016	1245	1.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219948

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,898,668	V249A	possibly damaging	Het
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
9930111J21Rik2	C	G	11: 49,019,322	L761F	probably damaging	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Abca14	T	C	7: 120,289,541	Y1237H	probably benign	Het
Abi3bp	T	G	16: 56,613,203	L550R	probably benign	Het
Abi3bp	C	T	16: 56,650,725	R578*	probably null	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ahdc1	A	G	4: 133,065,909	E1487G	possibly damaging	Het
AI987944	T	C	7: 41,374,526	E343G	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Atp1b1	G	T	1: 164,453,515	T11K	probably benign	Het
Calr3	A	G	8: 72,434,839	L40S	probably damaging	Het
Ccar1	A	C	10: 62,745,287	D1119E	unknown	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Cdk12	T	G	11: 98,210,638	S441A	unknown	Het
Ces4a	T	A	8: 105,146,114	V333E	probably damaging	Het
Cfap61	T	C	2: 146,214,680	L1193P	probably damaging	Het
Chd2	A	T	7: 73,478,668	D856E	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Cln3	T	A	7: 126,579,218	H211L	probably benign	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Dcstamp	T	A	15: 39,754,312	V39E	probably damaging	Het
Dicer1	C	T	12: 104,731,038	V87M	possibly damaging	Het
Duox1	A	G	2: 122,344,713	T1331A	probably benign	Het
Fam184a	T	A	10: 53,652,434	Q29L	probably damaging	Het
Fcer2a	T	C	8: 3,688,557	E60G	possibly damaging	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Fnbp1l	A	T	3: 122,546,962	M463K	probably benign	Het
Garem2	A	G	5: 30,114,764	D408G	probably benign	Het
Gm12169	A	G	11: 46,528,567	N70S	probably benign	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Gpc3	T	A	X: 52,397,206	I344F	probably damaging	Het
Gtf2e1	T	A	16: 37,511,542	E390D	possibly damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Il15ra	T	A	2: 11,718,344		probably null	Het
Ints8	A	T	4: 11,225,712	M615K	possibly damaging	Het
Irak1	G	A	X: 74,017,138	T193I	probably damaging	Het
Jmjd1c	A	G	10: 67,239,463		probably null	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Letm1	C	A	5: 33,769,486	V156L	possibly damaging	Het
Lrrc24	G	A	15: 76,722,911	P95L	probably damaging	Het
Map2k2	T	C	10: 81,119,379	S14P	probably damaging	Het
Me3	T	C	7: 89,850,381	Y535H	probably damaging	Het
Nfatc2ip	T	C	7: 126,391,295	E178G	probably benign	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr164	C	T	16: 19,286,297	A149T	probably benign	Het
Olfr714	T	A	7: 107,074,316	W163R	probably damaging	Het
Pbrm1	A	G	14: 31,032,449	D142G	possibly damaging	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Pdlim2	C	T	14: 70,164,779	R296H	probably damaging	Het
Pid1	T	A	1: 84,038,438	I69F	probably damaging	Het
Pkhd1	A	G	1: 20,537,360	S1091P	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Plxnd1	T	C	6: 115,962,764	N1418S	probably benign	Het
Pmm1	T	C	15: 81,956,400	T82A	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Ptprz1	C	T	6: 23,000,650	T913M	possibly damaging	Het
Ralgapa1	T	C	12: 55,612,800		probably null	Het
Rbm8a2	T	C	1: 175,978,854	E19G	possibly damaging	Het
Rgs3	T	C	4: 62,690,504	S336P	probably damaging	Het
Serpina11	G	T	12: 103,985,974	T179K	probably damaging	Het
Serpina1f	T	C	12: 103,693,396	N209S	possibly damaging	Het
Serpinf2	G	A	11: 75,436,762	T159I	probably benign	Het
Slc19a1	T	C	10: 77,041,924	C98R	possibly damaging	Het
Slc22a20	A	T	19: 5,971,525	I483N	possibly damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Tex45	A	T	8: 3,479,028	D201V	probably benign	Het
Tln1	C	T	4: 43,553,083		probably null	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tmx3	T	C	18: 90,527,913	F206S	probably damaging	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Ube3b	G	A	5: 114,389,074	V118M	probably damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Vmn2r53	T	A	7: 12,601,439	Y98F	probably damaging	Het
Vmn2r58	T	A	7: 41,864,170	N350Y	probably benign	Het
Vmn2r82	A	T	10: 79,356,685	H32L	probably benign	Het
Wsb1	T	C	11: 79,240,386	I395V	probably benign	Het
Zfat	T	C	15: 68,179,860	D695G	probably benign	Het
Zfp358	G	T	8: 3,496,995	V526F	possibly damaging	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zmat1	A	G	X: 134,973,112	L476P	possibly damaging	Het

Other mutations in Trappc10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Trappc10	APN	10	78203877	splice site	probably benign
IGL01375:Trappc10	APN	10	78188899	missense	possibly damaging	0.75
IGL01413:Trappc10	APN	10	78197844	missense	possibly damaging	0.87
IGL02413:Trappc10	APN	10	78210776	missense	probably damaging	0.99
IGL03037:Trappc10	APN	10	78199035	unclassified	probably benign
IGL03094:Trappc10	APN	10	78228920	splice site	probably benign
IGL03164:Trappc10	APN	10	78220242	missense	probably damaging	1.00
IGL03351:Trappc10	APN	10	78188761	missense	probably damaging	1.00
IGL03055:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
IGL03098:Trappc10	UTSW	10	78214686	missense	probably damaging	1.00
R0304:Trappc10	UTSW	10	78210760	splice site	probably benign
R0605:Trappc10	UTSW	10	78201497	missense	possibly damaging	0.70
R1806:Trappc10	UTSW	10	78210776	missense	probably damaging	0.99
R1856:Trappc10	UTSW	10	78196451	missense	probably benign	0.00
R2045:Trappc10	UTSW	10	78209479	splice site	probably benign
R2088:Trappc10	UTSW	10	78196334	missense	probably benign	0.00
R2126:Trappc10	UTSW	10	78203924	missense	possibly damaging	0.94
R2509:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2510:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2511:Trappc10	UTSW	10	78211523	missense	possibly damaging	0.51
R2893:Trappc10	UTSW	10	78193401	missense	probably benign	0.00
R3744:Trappc10	UTSW	10	78199090	missense	probably benign	0.00
R3778:Trappc10	UTSW	10	78200802	missense	possibly damaging	0.89
R3876:Trappc10	UTSW	10	78220186	splice site	probably null
R3930:Trappc10	UTSW	10	78210403	missense	probably benign	0.03
R4078:Trappc10	UTSW	10	78210382	missense	probably damaging	1.00
R4111:Trappc10	UTSW	10	78196430	missense	probably benign	0.09
R4418:Trappc10	UTSW	10	78217188	missense	probably damaging	1.00
R4549:Trappc10	UTSW	10	78231458	missense	probably damaging	1.00
R4695:Trappc10	UTSW	10	78197863	missense	probably damaging	0.99
R4799:Trappc10	UTSW	10	78201590	missense	possibly damaging	0.71
R5022:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5023:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5026:Trappc10	UTSW	10	78204288	missense	possibly damaging	0.82
R5057:Trappc10	UTSW	10	78217160	missense	possibly damaging	0.72
R5282:Trappc10	UTSW	10	78187860	missense	probably damaging	1.00
R5363:Trappc10	UTSW	10	78188840	missense	possibly damaging	0.92
R5813:Trappc10	UTSW	10	78222739	missense	probably damaging	1.00
R5831:Trappc10	UTSW	10	78209426	missense	probably damaging	1.00
R6209:Trappc10	UTSW	10	78214812	missense	possibly damaging	0.50
R6450:Trappc10	UTSW	10	78209450	missense	possibly damaging	0.92
R6520:Trappc10	UTSW	10	78201453	missense	probably benign	0.00
R6533:Trappc10	UTSW	10	78188894	missense	probably damaging	0.96
R6767:Trappc10	UTSW	10	78193511	missense	possibly damaging	0.75
R6798:Trappc10	UTSW	10	78188831	missense	probably benign	0.00
R7205:Trappc10	UTSW	10	78210428	missense	probably damaging	1.00
R7282:Trappc10	UTSW	10	78207493	missense	probably damaging	0.98
R7378:Trappc10	UTSW	10	78193418	missense	probably damaging	0.96
R7384:Trappc10	UTSW	10	78209384	missense	possibly damaging	0.85
R7770:Trappc10	UTSW	10	78210845	missense	probably damaging	0.96
R7829:Trappc10	UTSW	10	78199075	missense	probably benign
R7839:Trappc10	UTSW	10	78188812	missense	possibly damaging	0.84
R8298:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R8306:Trappc10	UTSW	10	78200626	missense	possibly damaging	0.54
R8814:Trappc10	UTSW	10	78202919	missense	probably damaging	1.00
R9035:Trappc10	UTSW	10	78207889	unclassified	probably benign
R9075:Trappc10	UTSW	10	78204296	missense	possibly damaging	0.77
R9112:Trappc10	UTSW	10	78193367	missense	probably damaging	0.99
R9182:Trappc10	UTSW	10	78214630	missense	probably damaging	1.00
R9444:Trappc10	UTSW	10	78197778	missense	probably benign	0.10
R9801:Trappc10	UTSW	10	78209429	missense	probably benign	0.00
Z1177:Trappc10	UTSW	10	78217153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGATCCGATCTGAACTTCACC -3'
(R):5'- TCAGGACAGTGATGGTGAACC -3'

Sequencing Primer
(F):5'- TTCACCTAAAACTTTACCCTGACATG -3'
(R):5'- CCAGAGAGAAGCCACTGTGC -3'

Posted On

2014-10-02