Incidental Mutation 'R2202:Pdlim2'
ID 238780
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 040204-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R2202 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 70402228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 296 (R296H)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: R97H
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: R97H

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Meta Mutation Damage Score 0.8007 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 64,056,011 (GRCm39) V249A possibly damaging Het
9930111J21Rik2 C G 11: 48,910,149 (GRCm39) L761F probably damaging Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Abca14 T C 7: 119,888,764 (GRCm39) Y1237H probably benign Het
Abi3bp C T 16: 56,471,088 (GRCm39) R578* probably null Het
Abi3bp T G 16: 56,433,566 (GRCm39) L550R probably benign Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ahdc1 A G 4: 132,793,220 (GRCm39) E1487G possibly damaging Het
AI987944 T C 7: 41,023,950 (GRCm39) E343G probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Atp1b1 G T 1: 164,281,084 (GRCm39) T11K probably benign Het
Calr3 A G 8: 73,188,683 (GRCm39) L40S probably damaging Het
Ccar1 A C 10: 62,581,066 (GRCm39) D1119E unknown Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Cdk12 T G 11: 98,101,464 (GRCm39) S441A unknown Het
Ces4a T A 8: 105,872,746 (GRCm39) V333E probably damaging Het
Cfap61 T C 2: 146,056,600 (GRCm39) L1193P probably damaging Het
Chd2 A T 7: 73,128,416 (GRCm39) D856E probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Cln3 T A 7: 126,178,390 (GRCm39) H211L probably benign Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Dcstamp T A 15: 39,617,708 (GRCm39) V39E probably damaging Het
Dicer1 C T 12: 104,697,297 (GRCm39) V87M possibly damaging Het
Duox1 A G 2: 122,175,194 (GRCm39) T1331A probably benign Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Fam184a T A 10: 53,528,530 (GRCm39) Q29L probably damaging Het
Fcer2a T C 8: 3,738,557 (GRCm39) E60G possibly damaging Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Fnbp1l A T 3: 122,340,611 (GRCm39) M463K probably benign Het
Garem2 A G 5: 30,319,762 (GRCm39) D408G probably benign Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Gpc3 T A X: 51,486,083 (GRCm39) I344F probably damaging Het
Gtf2e1 T A 16: 37,331,904 (GRCm39) E390D possibly damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Il15ra T A 2: 11,723,155 (GRCm39) probably null Het
Ints8 A T 4: 11,225,712 (GRCm39) M615K possibly damaging Het
Irak1 G A X: 73,060,744 (GRCm39) T193I probably damaging Het
Jmjd1c A G 10: 67,075,242 (GRCm39) probably null Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Letm1 C A 5: 33,926,830 (GRCm39) V156L possibly damaging Het
Lrrc24 G A 15: 76,607,111 (GRCm39) P95L probably damaging Het
Map2k2 T C 10: 80,955,213 (GRCm39) S14P probably damaging Het
Me3 T C 7: 89,499,589 (GRCm39) Y535H probably damaging Het
Nfatc2ip T C 7: 125,990,467 (GRCm39) E178G probably benign Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10a2 T A 7: 106,673,523 (GRCm39) W163R probably damaging Het
Or2m12 C T 16: 19,105,047 (GRCm39) A149T probably benign Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Pbrm1 A G 14: 30,754,406 (GRCm39) D142G possibly damaging Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Pid1 T A 1: 84,016,159 (GRCm39) I69F probably damaging Het
Pkhd1 A G 1: 20,607,584 (GRCm39) S1091P probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Plxnd1 T C 6: 115,939,725 (GRCm39) N1418S probably benign Het
Pmm1 T C 15: 81,840,601 (GRCm39) T82A probably benign Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Ptprz1 C T 6: 23,000,649 (GRCm39) T913M possibly damaging Het
Ralgapa1 T C 12: 55,659,585 (GRCm39) probably null Het
Rbm8a2 T C 1: 175,806,420 (GRCm39) E19G possibly damaging Het
Rgs3 T C 4: 62,608,741 (GRCm39) S336P probably damaging Het
Saxo5 A T 8: 3,529,028 (GRCm39) D201V probably benign Het
Serpina11 G T 12: 103,952,233 (GRCm39) T179K probably damaging Het
Serpina1f T C 12: 103,659,655 (GRCm39) N209S possibly damaging Het
Serpinf2 G A 11: 75,327,588 (GRCm39) T159I probably benign Het
Slc19a1 T C 10: 76,877,758 (GRCm39) C98R possibly damaging Het
Slc22a20 A T 19: 6,021,553 (GRCm39) I483N possibly damaging Het
Spata31d1d A G 13: 59,879,435 (GRCm39) C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Timd5 A G 11: 46,419,394 (GRCm39) N70S probably benign Het
Tln1 C T 4: 43,553,083 (GRCm39) probably null Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Tmx3 T C 18: 90,546,037 (GRCm39) F206S probably damaging Het
Tnfsf14 T C 17: 57,497,638 (GRCm39) D198G possibly damaging Het
Trappc10 A G 10: 78,034,876 (GRCm39) probably null Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Ube3b G A 5: 114,527,135 (GRCm39) V118M probably damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Vmn2r53 T A 7: 12,335,366 (GRCm39) Y98F probably damaging Het
Vmn2r58 T A 7: 41,513,594 (GRCm39) N350Y probably benign Het
Vmn2r82 A T 10: 79,192,519 (GRCm39) H32L probably benign Het
Wsb1 T C 11: 79,131,212 (GRCm39) I395V probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfat T C 15: 68,051,709 (GRCm39) D695G probably benign Het
Zfp358 G T 8: 3,546,995 (GRCm39) V526F possibly damaging Het
Zmat1 A G X: 133,873,861 (GRCm39) L476P possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCAGTATAATCATGTCTGC -3'
(R):5'- GGGGTTGGTAAAATGAAATTCCTG -3'

Sequencing Primer
(F):5'- AATCATGTCTGCAGAGTCTGAG -3'
(R):5'- AAATTCCTGAGAGAGAGGCTTTTG -3'
Posted On 2014-10-02