Incidental Mutation 'R2203:Ttc39a'
ID238826
Institutional Source Beutler Lab
Gene Symbol Ttc39a
Ensembl Gene ENSMUSG00000028555
Gene Nametetratricopeptide repeat domain 39A
Synonyms4922503N01Rik
MMRRC Submission 040205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2203 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109406623-109444745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109431588 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 293 (N293S)
Ref Sequence ENSEMBL: ENSMUSP00000066334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064129] [ENSMUST00000106618] [ENSMUST00000124209] [ENSMUST00000153315]
Predicted Effect probably benign
Transcript: ENSMUST00000064129
AA Change: N293S

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066334
Gene: ENSMUSG00000028555
AA Change: N293S

DomainStartEndE-ValueType
TPR 278 311 7.69e1 SMART
TPR 468 501 6.57e1 SMART
TPR 509 542 1.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106618
AA Change: N295S

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102229
Gene: ENSMUSG00000028555
AA Change: N295S

DomainStartEndE-ValueType
TPR 280 313 7.69e1 SMART
TPR 470 503 6.57e1 SMART
TPR 511 544 1.42e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124209
SMART Domains Protein: ENSMUSP00000118672
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
Pfam:DUF3808 1 137 6.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153315
SMART Domains Protein: ENSMUSP00000117621
Gene: ENSMUSG00000028555

DomainStartEndE-ValueType
Pfam:DUF3808 1 160 2.6e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abcc5 C G 16: 20,405,882 L44F possibly damaging Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Brca2 T A 5: 150,539,502 D910E possibly damaging Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Ccdc66 T A 14: 27,486,833 D488V probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Clptm1 G T 7: 19,633,892 F598L possibly damaging Het
Cntrl G A 2: 35,143,737 V257I possibly damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Crebbp A C 16: 4,138,777 M394R possibly damaging Het
Ctnnd1 A G 2: 84,616,680 L407P probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gapdh A T 6: 125,162,606 S165T probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Grik4 T A 9: 42,547,655 S596C probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Htr5b T C 1: 121,527,964 T76A probably damaging Het
Iars A G 13: 49,722,675 E812G probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Kcnj5 T C 9: 32,322,900 T40A probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Med26 T C 8: 72,495,902 E451G probably damaging Het
Nbeal1 T A 1: 60,284,006 M2081K probably benign Het
Nectin4 G A 1: 171,386,229 V433M possibly damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pkd1 G T 17: 24,580,889 A591S probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Rabep1 A C 11: 70,934,574 E689A probably damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Saxo1 A C 4: 86,445,761 Y162D probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l2 A T 8: 125,491,627 W324R probably damaging Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc26a8 G T 17: 28,648,007 L583I probably benign Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfp712 T A 13: 67,041,984 T160S probably benign Het
Other mutations in Ttc39a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Ttc39a APN 4 109442345 splice site probably benign
IGL01143:Ttc39a APN 4 109442813 critical splice donor site probably null
IGL01802:Ttc39a APN 4 109433084 nonsense probably null
IGL01906:Ttc39a APN 4 109421394 missense probably benign 0.04
IGL02115:Ttc39a APN 4 109426294 splice site probably benign
IGL02415:Ttc39a APN 4 109431529 unclassified probably benign
IGL02658:Ttc39a APN 4 109422893 missense probably damaging 1.00
IGL02728:Ttc39a APN 4 109442723 missense probably damaging 1.00
IGL03281:Ttc39a APN 4 109433022 missense possibly damaging 0.84
R0030:Ttc39a UTSW 4 109422973 missense probably benign
R0103:Ttc39a UTSW 4 109421453 intron probably null
R0194:Ttc39a UTSW 4 109444179 missense probably benign
R0561:Ttc39a UTSW 4 109440602 missense probably damaging 1.00
R0603:Ttc39a UTSW 4 109426302 missense probably damaging 1.00
R2132:Ttc39a UTSW 4 109442706 missense probably damaging 1.00
R2473:Ttc39a UTSW 4 109442239 missense probably damaging 0.97
R4449:Ttc39a UTSW 4 109442303 missense possibly damaging 0.82
R4809:Ttc39a UTSW 4 109416021 nonsense probably null
R5266:Ttc39a UTSW 4 109422504 missense probably benign 0.04
R5590:Ttc39a UTSW 4 109432987 critical splice acceptor site probably null
R5911:Ttc39a UTSW 4 109422971 missense possibly damaging 0.79
R5930:Ttc39a UTSW 4 109430878 missense probably benign
R7058:Ttc39a UTSW 4 109431566 missense probably damaging 1.00
X0013:Ttc39a UTSW 4 109433137 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTACCCGAGCAATGTACCTCC -3'
(R):5'- TTCCTATCAAAAGGCACCTCTC -3'

Sequencing Primer
(F):5'- GGTACTGGGAATGTCAACATCG -3'
(R):5'- TATCAAAAGGCACCTCTCTCCTC -3'
Posted On2014-10-02