Incidental Mutation 'R0180:Fermt3'
ID23883
Institutional Source Beutler Lab
Gene Symbol Fermt3
Ensembl Gene ENSMUSG00000024965
Gene Namefermitin family member 3
SynonymsKindlin-3, C79673
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0180 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location6998958-7019469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7002343 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 474 (S474I)
Ref Sequence ENSEMBL: ENSMUSP00000037858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040772] [ENSMUST00000088223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040772
AA Change: S474I

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037858
Gene: ENSMUSG00000024965
AA Change: S474I

DomainStartEndE-ValueType
Blast:B41 14 77 6e-32 BLAST
B41 94 556 1.66e-28 SMART
PH 350 455 2.26e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088223
SMART Domains Protein: ENSMUSP00000085555
Gene: ENSMUSG00000047656

DomainStartEndE-ValueType
Pfam:PTS_2-RNA 21 198 2.6e-67 PFAM
Meta Mutation Damage Score 0.1314 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kindlins are a small family of proteins that mediate protein-protein interactions involved in integrin activation and thereby have a role in cell adhesion, migration, differentiation, and proliferation. The protein encoded by this gene has a key role in the regulation of hemostasis and thrombosis. This protein may also help maintain the membrane skeleton of erythrocytes. Mutations in this gene cause the autosomal recessive leukocyte adhesion deficiency syndrome-III (LAD-III). Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2010]
PHENOTYPE: Disruption of this marker results in lethality in the first week after birth, abnormal erythropoiesis and platelet function, and severe hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Frg1 T A 8: 41,399,068 probably null Het
Gbf1 T C 19: 46,285,722 S1732P probably benign Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Fermt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fermt3 APN 19 7003258 unclassified probably null
IGL01724:Fermt3 APN 19 7001775 missense probably damaging 0.99
IGL01748:Fermt3 APN 19 7003466 critical splice donor site probably null
IGL02392:Fermt3 APN 19 7018815 missense probably benign 0.35
IGL02956:Fermt3 APN 19 7002344 missense probably benign 0.40
IGL03146:Fermt3 APN 19 7003263 missense possibly damaging 0.88
IGL03216:Fermt3 APN 19 6999380 missense probably benign 0.00
P0026:Fermt3 UTSW 19 7014424 missense probably damaging 0.99
R0445:Fermt3 UTSW 19 7003299 missense probably benign 0.29
R1202:Fermt3 UTSW 19 7003482 missense probably damaging 1.00
R1475:Fermt3 UTSW 19 7018874 intron probably null
R1668:Fermt3 UTSW 19 7018692 missense probably damaging 1.00
R2179:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R2311:Fermt3 UTSW 19 7014162 missense probably damaging 0.97
R3976:Fermt3 UTSW 19 7002424 missense possibly damaging 0.74
R4087:Fermt3 UTSW 19 7003577 critical splice acceptor site probably null
R4667:Fermt3 UTSW 19 7002920 missense probably damaging 1.00
R6108:Fermt3 UTSW 19 7014414 missense probably benign 0.14
R6452:Fermt3 UTSW 19 7014737 missense probably benign 0.00
R6994:Fermt3 UTSW 19 6999727 missense probably damaging 1.00
R7334:Fermt3 UTSW 19 7003038 missense probably benign 0.03
R7357:Fermt3 UTSW 19 7002843 missense probably benign
Z1177:Fermt3 UTSW 19 7014679 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCTAAGGAAGAGTGTGCTGTTGGAG -3'
(R):5'- AGATCTACCTGAGGTGCCAGGATG -3'

Sequencing Primer
(F):5'- TCCAGGGGTCAAGGGTG -3'
(R):5'- AGTAGGACTGAACTTGCACTC -3'
Posted On2013-04-16