Incidental Mutation 'R2203:Kcnj5'
ID238838
Institutional Source Beutler Lab
Gene Symbol Kcnj5
Ensembl Gene ENSMUSG00000032034
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 5
SynonymsGIRK4, Kir3.4
MMRRC Submission 040205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2203 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32314707-32344350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32322900 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000149000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034533] [ENSMUST00000214223] [ENSMUST00000216033]
Predicted Effect probably benign
Transcript: ENSMUST00000034533
AA Change: T40A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034533
Gene: ENSMUSG00000032034
AA Change: T40A

DomainStartEndE-ValueType
Pfam:IRK 54 377 7e-147 PFAM
low complexity region 387 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214223
AA Change: T40A

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000216033
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It may associate with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit mild resting tachycardias and reduced muscarinic-gated atrial potassium channel responses to pharmacological stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abcc5 C G 16: 20,405,882 L44F possibly damaging Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Brca2 T A 5: 150,539,502 D910E possibly damaging Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Ccdc66 T A 14: 27,486,833 D488V probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Clptm1 G T 7: 19,633,892 F598L possibly damaging Het
Cntrl G A 2: 35,143,737 V257I possibly damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Crebbp A C 16: 4,138,777 M394R possibly damaging Het
Ctnnd1 A G 2: 84,616,680 L407P probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gapdh A T 6: 125,162,606 S165T probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Grik4 T A 9: 42,547,655 S596C probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Htr5b T C 1: 121,527,964 T76A probably damaging Het
Iars A G 13: 49,722,675 E812G probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Knstrn T A 2: 118,830,975 probably null Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Med26 T C 8: 72,495,902 E451G probably damaging Het
Nbeal1 T A 1: 60,284,006 M2081K probably benign Het
Nectin4 G A 1: 171,386,229 V433M possibly damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pkd1 G T 17: 24,580,889 A591S probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Rabep1 A C 11: 70,934,574 E689A probably damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Saxo1 A C 4: 86,445,761 Y162D probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l2 A T 8: 125,491,627 W324R probably damaging Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc26a8 G T 17: 28,648,007 L583I probably benign Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttc39a A G 4: 109,431,588 N293S probably benign Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfp712 T A 13: 67,041,984 T160S probably benign Het
Other mutations in Kcnj5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Kcnj5 APN 9 32322423 missense probably damaging 1.00
IGL01700:Kcnj5 APN 9 32322629 missense probably damaging 1.00
IGL02250:Kcnj5 APN 9 32317756 missense probably damaging 1.00
IGL02683:Kcnj5 APN 9 32317780 missense possibly damaging 0.94
IGL02981:Kcnj5 APN 9 32322581 missense probably damaging 1.00
R0388:Kcnj5 UTSW 9 32317863 missense probably damaging 1.00
R0464:Kcnj5 UTSW 9 32322973 missense possibly damaging 0.87
R0524:Kcnj5 UTSW 9 32322974 missense probably benign 0.16
R1711:Kcnj5 UTSW 9 32322569 missense probably damaging 1.00
R1730:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R1783:Kcnj5 UTSW 9 32322192 missense probably damaging 1.00
R2424:Kcnj5 UTSW 9 32322820 missense probably damaging 1.00
R3701:Kcnj5 UTSW 9 32317828 missense possibly damaging 0.95
R4459:Kcnj5 UTSW 9 32322395 missense probably damaging 1.00
R4657:Kcnj5 UTSW 9 32322677 missense probably benign
R5422:Kcnj5 UTSW 9 32317705 missense probably benign 0.00
R6073:Kcnj5 UTSW 9 32317800 missense probably damaging 1.00
R7185:Kcnj5 UTSW 9 32322176 missense probably damaging 1.00
R7289:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7294:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7295:Kcnj5 UTSW 9 32322791 missense probably damaging 1.00
R7296:Kcnj5 UTSW 9 32322749 missense probably damaging 1.00
R7450:Kcnj5 UTSW 9 32322195 missense possibly damaging 0.52
R7688:Kcnj5 UTSW 9 32322968 missense probably benign 0.00
R7911:Kcnj5 UTSW 9 32322221 missense probably damaging 1.00
Z1177:Kcnj5 UTSW 9 32317698 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTGTAGACCATGGTGAAGACC -3'
(R):5'- TCCCATGAGAGTTCCCAGAAG -3'

Sequencing Primer
(F):5'- CCAGAAGGTTGAAGCGCCATTTG -3'
(R):5'- GGAAGTAGCCTCCAGTTCTAAATC -3'
Posted On2014-10-02