Incidental Mutation 'R2203:Rabep1'
ID238848
Institutional Source Beutler Lab
Gene Symbol Rabep1
Ensembl Gene ENSMUSG00000020817
Gene Namerabaptin, RAB GTPase binding effector protein 1
Synonymsneurocrescin, RAB5 effector protein, rabaptin-5
MMRRC Submission 040205-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R2203 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70844778-70943105 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 70934574 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 689 (E689A)
Ref Sequence ENSEMBL: ENSMUSP00000137267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076270] [ENSMUST00000081362] [ENSMUST00000100928] [ENSMUST00000108533] [ENSMUST00000177731] [ENSMUST00000178245]
Predicted Effect probably damaging
Transcript: ENSMUST00000076270
AA Change: E732A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075619
Gene: ENSMUSG00000020817
AA Change: E732A

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.8e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 596 7.6e-39 PFAM
Pfam:Rab5-bind 612 807 5.7e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081362
AA Change: E692A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080102
Gene: ENSMUSG00000020817
AA Change: E692A

DomainStartEndE-ValueType
Pfam:Rabaptin 89 198 2.4e-45 PFAM
low complexity region 274 287 N/A INTRINSIC
Pfam:Rabaptin 421 556 7.1e-39 PFAM
Pfam:Rab5-bind 572 767 5.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100928
AA Change: E697A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098488
Gene: ENSMUSG00000020817
AA Change: E697A

DomainStartEndE-ValueType
Pfam:Rabaptin 89 195 8.3e-47 PFAM
low complexity region 314 327 N/A INTRINSIC
Pfam:Rabaptin 461 561 2.9e-27 PFAM
Pfam:Rab5-bind 577 772 5.3e-51 PFAM
low complexity region 803 817 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108533
AA Change: E732A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104173
Gene: ENSMUSG00000020817
AA Change: E732A

DomainStartEndE-ValueType
Pfam:Rabaptin 9 495 2.8e-301 PFAM
Pfam:Rab5-bind 533 841 2e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142220
Predicted Effect probably damaging
Transcript: ENSMUST00000177731
AA Change: E648A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136069
Gene: ENSMUSG00000020817
AA Change: E648A

DomainStartEndE-ValueType
Pfam:Rabaptin 5 111 6.2e-47 PFAM
low complexity region 230 243 N/A INTRINSIC
Pfam:Rabaptin 377 512 5.3e-39 PFAM
Pfam:Rab5-bind 528 723 1.4e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178245
AA Change: E689A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137267
Gene: ENSMUSG00000020817
AA Change: E689A

DomainStartEndE-ValueType
Pfam:Rabaptin 46 152 8.2e-47 PFAM
low complexity region 271 284 N/A INTRINSIC
Pfam:Rabaptin 418 553 7e-39 PFAM
Pfam:Rab5-bind 569 764 5.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abcc5 C G 16: 20,405,882 L44F possibly damaging Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Brca2 T A 5: 150,539,502 D910E possibly damaging Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Ccdc66 T A 14: 27,486,833 D488V probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Clptm1 G T 7: 19,633,892 F598L possibly damaging Het
Cntrl G A 2: 35,143,737 V257I possibly damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Crebbp A C 16: 4,138,777 M394R possibly damaging Het
Ctnnd1 A G 2: 84,616,680 L407P probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gapdh A T 6: 125,162,606 S165T probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Grik4 T A 9: 42,547,655 S596C probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Htr5b T C 1: 121,527,964 T76A probably damaging Het
Iars A G 13: 49,722,675 E812G probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Kcnj5 T C 9: 32,322,900 T40A probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Med26 T C 8: 72,495,902 E451G probably damaging Het
Nbeal1 T A 1: 60,284,006 M2081K probably benign Het
Nectin4 G A 1: 171,386,229 V433M possibly damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pkd1 G T 17: 24,580,889 A591S probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Saxo1 A C 4: 86,445,761 Y162D probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l2 A T 8: 125,491,627 W324R probably damaging Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc26a8 G T 17: 28,648,007 L583I probably benign Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttc39a A G 4: 109,431,588 N293S probably benign Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfp712 T A 13: 67,041,984 T160S probably benign Het
Other mutations in Rabep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Rabep1 APN 11 70925781 missense probably benign 0.00
IGL02022:Rabep1 APN 11 70934559 missense probably damaging 1.00
IGL02215:Rabep1 APN 11 70923197 nonsense probably null
IGL02428:Rabep1 APN 11 70917480 missense probably benign 0.00
IGL02566:Rabep1 APN 11 70917714 missense probably damaging 1.00
IGL02868:Rabep1 APN 11 70874746 missense probably benign 0.00
F5770:Rabep1 UTSW 11 70937516 splice site probably benign
P0042:Rabep1 UTSW 11 70884975 splice site probably benign
PIT4495001:Rabep1 UTSW 11 70917579 missense probably damaging 1.00
R0328:Rabep1 UTSW 11 70919207 missense probably damaging 1.00
R0458:Rabep1 UTSW 11 70886998 splice site probably null
R0477:Rabep1 UTSW 11 70920907 missense probably damaging 1.00
R0727:Rabep1 UTSW 11 70900492 nonsense probably null
R1732:Rabep1 UTSW 11 70904641 missense probably damaging 1.00
R1837:Rabep1 UTSW 11 70904658 missense probably damaging 1.00
R4003:Rabep1 UTSW 11 70917367 missense probably benign 0.12
R4229:Rabep1 UTSW 11 70908434 missense probably benign
R4573:Rabep1 UTSW 11 70917751 missense probably damaging 1.00
R4748:Rabep1 UTSW 11 70908468 missense probably benign 0.18
R5130:Rabep1 UTSW 11 70904731 missense probably damaging 1.00
R5182:Rabep1 UTSW 11 70904628 nonsense probably null
R5379:Rabep1 UTSW 11 70908421 missense probably damaging 1.00
R5525:Rabep1 UTSW 11 70923146 missense probably damaging 1.00
R5617:Rabep1 UTSW 11 70917529 missense probably damaging 1.00
R6283:Rabep1 UTSW 11 70917679 missense probably damaging 1.00
R6302:Rabep1 UTSW 11 70935121 missense probably damaging 1.00
R6730:Rabep1 UTSW 11 70940386 missense possibly damaging 0.88
R6988:Rabep1 UTSW 11 70934537 missense probably damaging 0.96
R7235:Rabep1 UTSW 11 70940464 missense probably benign 0.43
R7241:Rabep1 UTSW 11 70939989 missense probably damaging 1.00
R7453:Rabep1 UTSW 11 70917660 missense probably damaging 1.00
R7955:Rabep1 UTSW 11 70917441 missense probably damaging 0.96
R8175:Rabep1 UTSW 11 70884929 missense probably damaging 1.00
R8314:Rabep1 UTSW 11 70893660 missense possibly damaging 0.93
R8461:Rabep1 UTSW 11 70884855 missense possibly damaging 0.56
R8481:Rabep1 UTSW 11 70887127 missense probably damaging 1.00
R8530:Rabep1 UTSW 11 70919242 missense probably damaging 1.00
R8531:Rabep1 UTSW 11 70908506 missense probably benign 0.01
Z1186:Rabep1 UTSW 11 70940084 frame shift probably null
Z1187:Rabep1 UTSW 11 70940084 frame shift probably null
Z1188:Rabep1 UTSW 11 70940084 frame shift probably null
Z1189:Rabep1 UTSW 11 70940084 frame shift probably null
Z1190:Rabep1 UTSW 11 70940084 frame shift probably null
Z1191:Rabep1 UTSW 11 70940084 frame shift probably null
Z1192:Rabep1 UTSW 11 70940084 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTACGGAATCCAGGTGCTCC -3'
(R):5'- AGGGCTTTCACAGTGACTG -3'

Sequencing Primer
(F):5'- CGGGAACTGGTTTTAAAATATCGTG -3'
(R):5'- ACCGAGGACAGCTGTTCTTTTATAC -3'
Posted On2014-10-02