Incidental Mutation 'R2203:Spata31d1d'
ID238854
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Namespermatogenesis associated 31 subfamily D, member 1D
Synonyms
MMRRC Submission 040205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2203 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59725925-59731752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59731621 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 34 (C34R)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052978
AA Change: C34R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: C34R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abcc5 C G 16: 20,405,882 L44F possibly damaging Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Brca2 T A 5: 150,539,502 D910E possibly damaging Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Ccdc66 T A 14: 27,486,833 D488V probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Clptm1 G T 7: 19,633,892 F598L possibly damaging Het
Cntrl G A 2: 35,143,737 V257I possibly damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Crebbp A C 16: 4,138,777 M394R possibly damaging Het
Ctnnd1 A G 2: 84,616,680 L407P probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gapdh A T 6: 125,162,606 S165T probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Grik4 T A 9: 42,547,655 S596C probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Htr5b T C 1: 121,527,964 T76A probably damaging Het
Iars A G 13: 49,722,675 E812G probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Kcnj5 T C 9: 32,322,900 T40A probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Med26 T C 8: 72,495,902 E451G probably damaging Het
Nbeal1 T A 1: 60,284,006 M2081K probably benign Het
Nectin4 G A 1: 171,386,229 V433M possibly damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pkd1 G T 17: 24,580,889 A591S probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Rabep1 A C 11: 70,934,574 E689A probably damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Saxo1 A C 4: 86,445,761 Y162D probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l2 A T 8: 125,491,627 W324R probably damaging Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc26a8 G T 17: 28,648,007 L583I probably benign Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttc39a A G 4: 109,431,588 N293S probably benign Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfp712 T A 13: 67,041,984 T160S probably benign Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59730215 splice site probably benign
IGL02399:Spata31d1d APN 13 59730140 splice site probably benign
IGL02531:Spata31d1d APN 13 59727934 missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59727864 missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59726864 missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59725979 missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59726133 missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59728243 missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59727973 missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59726024 missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59728191 missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59726497 missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59728695 missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59728122 missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2204:Spata31d1d UTSW 13 59731621 missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59726955 missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59727462 missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59728554 missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59729241 missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59727288 missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59727520 missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59728778 missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59726400 missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59726508 missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59728686 missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59727240 missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59727015 missense probably benign
R6263:Spata31d1d UTSW 13 59725983 missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59728464 missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59726057 missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59731615 missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59728232 missense probably benign
R7174:Spata31d1d UTSW 13 59728580 missense possibly damaging 0.72
R7322:Spata31d1d UTSW 13 59726976 missense probably benign
R7444:Spata31d1d UTSW 13 59727193 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCACAGTATCGTAACAGCTCAGG -3'
(R):5'- TTCCCTGCTCTGTGATGCAG -3'

Sequencing Primer
(F):5'- AGGTACTGCGCTCAGACAG -3'
(R):5'- AGGCCTGCCCACTTACAG -3'
Posted On2014-10-02