Incidental Mutation 'R2203:Cacna1h'
ID238867
Institutional Source Beutler Lab
Gene Symbol Cacna1h
Ensembl Gene ENSMUSG00000024112
Gene Namecalcium channel, voltage-dependent, T type, alpha 1H subunit
SynonymsCav3.2, alpha13.2, T-type Cav3.2
MMRRC Submission 040205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2203 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25374285-25433783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25380260 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1742 (A1742T)
Ref Sequence ENSEMBL: ENSMUSP00000125541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610]
Predicted Effect probably damaging
Transcript: ENSMUST00000078496
AA Change: A1742T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112
AA Change: A1742T

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159048
AA Change: A1636T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112
AA Change: A1636T

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159331
Predicted Effect probably damaging
Transcript: ENSMUST00000159610
AA Change: A1742T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112
AA Change: A1742T

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161035
AA Change: A56T
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112
AA Change: A56T

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000161658
AA Change: A7T
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-dependent Ca(2+) channels mediate the entry of Ca(2+) ions into excitable cells and are involved in a variety of Ca(2+)-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. The protein encoded by this gene is an integral membrane protein that belongs to the calcium channel alpha-1 subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutation of this locus results in constitutive coronary arteriole contraction and focal myocardial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abcc5 C G 16: 20,405,882 L44F possibly damaging Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Brca2 T A 5: 150,539,502 D910E possibly damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Ccdc66 T A 14: 27,486,833 D488V probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Clptm1 G T 7: 19,633,892 F598L possibly damaging Het
Cntrl G A 2: 35,143,737 V257I possibly damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Crebbp A C 16: 4,138,777 M394R possibly damaging Het
Ctnnd1 A G 2: 84,616,680 L407P probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gapdh A T 6: 125,162,606 S165T probably benign Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Grik4 T A 9: 42,547,655 S596C probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Htr5b T C 1: 121,527,964 T76A probably damaging Het
Iars A G 13: 49,722,675 E812G probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Kcnj5 T C 9: 32,322,900 T40A probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Med26 T C 8: 72,495,902 E451G probably damaging Het
Nbeal1 T A 1: 60,284,006 M2081K probably benign Het
Nectin4 G A 1: 171,386,229 V433M possibly damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pkd1 G T 17: 24,580,889 A591S probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Rabep1 A C 11: 70,934,574 E689A probably damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Saxo1 A C 4: 86,445,761 Y162D probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l2 A T 8: 125,491,627 W324R probably damaging Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc26a8 G T 17: 28,648,007 L583I probably benign Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttc39a A G 4: 109,431,588 N293S probably benign Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfp712 T A 13: 67,041,984 T160S probably benign Het
Other mutations in Cacna1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cacna1h APN 17 25381508 missense probably damaging 1.00
IGL01412:Cacna1h APN 17 25391950 missense probably benign 0.24
IGL01625:Cacna1h APN 17 25383485 missense probably damaging 0.97
IGL01625:Cacna1h APN 17 25385712 missense possibly damaging 0.95
IGL01684:Cacna1h APN 17 25388716 missense probably damaging 1.00
IGL01862:Cacna1h APN 17 25383483 missense probably damaging 1.00
IGL01877:Cacna1h APN 17 25388050 missense probably damaging 1.00
IGL02040:Cacna1h APN 17 25397611 missense probably benign 0.10
IGL02190:Cacna1h APN 17 25433026 missense probably benign
IGL02686:Cacna1h APN 17 25385749 missense possibly damaging 0.80
IGL02883:Cacna1h APN 17 25380532 missense probably damaging 1.00
IGL02945:Cacna1h APN 17 25388059 missense probably damaging 1.00
IGL03025:Cacna1h APN 17 25432894 nonsense probably null
IGL03095:Cacna1h APN 17 25383778 unclassified probably benign
IGL03207:Cacna1h APN 17 25391333 missense probably damaging 1.00
IGL02991:Cacna1h UTSW 17 25391312 missense possibly damaging 0.56
IGL03097:Cacna1h UTSW 17 25391144 missense probably damaging 1.00
R0010:Cacna1h UTSW 17 25380844 missense probably damaging 1.00
R0194:Cacna1h UTSW 17 25380924 unclassified probably benign
R0361:Cacna1h UTSW 17 25389422 missense probably damaging 1.00
R0501:Cacna1h UTSW 17 25388667 missense probably damaging 1.00
R0558:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R0588:Cacna1h UTSW 17 25387564 missense probably damaging 1.00
R0626:Cacna1h UTSW 17 25393546 missense possibly damaging 0.92
R0811:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0812:Cacna1h UTSW 17 25388628 missense probably damaging 1.00
R0964:Cacna1h UTSW 17 25378775 unclassified probably benign
R1351:Cacna1h UTSW 17 25391951 missense probably benign 0.14
R1457:Cacna1h UTSW 17 25397620 missense probably damaging 1.00
R1521:Cacna1h UTSW 17 25397354 missense possibly damaging 0.57
R1564:Cacna1h UTSW 17 25377861 nonsense probably null
R1611:Cacna1h UTSW 17 25381471 missense probably damaging 1.00
R1669:Cacna1h UTSW 17 25383471 missense probably damaging 1.00
R1835:Cacna1h UTSW 17 25392076 missense probably benign 0.01
R1858:Cacna1h UTSW 17 25380807 missense probably damaging 1.00
R1887:Cacna1h UTSW 17 25376887 missense probably benign 0.01
R2039:Cacna1h UTSW 17 25391845 missense probably benign 0.03
R2091:Cacna1h UTSW 17 25432876 missense possibly damaging 0.95
R2133:Cacna1h UTSW 17 25383528 missense probably damaging 1.00
R2205:Cacna1h UTSW 17 25380260 missense probably damaging 1.00
R2206:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2207:Cacna1h UTSW 17 25385013 missense probably benign 0.10
R2224:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2226:Cacna1h UTSW 17 25385943 missense probably benign 0.03
R2261:Cacna1h UTSW 17 25433165 missense possibly damaging 0.91
R2361:Cacna1h UTSW 17 25384012 missense probably damaging 1.00
R2917:Cacna1h UTSW 17 25395452 missense probably damaging 0.97
R3031:Cacna1h UTSW 17 25433134 missense probably damaging 0.99
R3856:Cacna1h UTSW 17 25392453 missense probably damaging 1.00
R4230:Cacna1h UTSW 17 25387863 missense probably damaging 1.00
R4408:Cacna1h UTSW 17 25380627 missense probably damaging 1.00
R4687:Cacna1h UTSW 17 25393910 missense possibly damaging 0.47
R4887:Cacna1h UTSW 17 25377287 missense possibly damaging 0.86
R4895:Cacna1h UTSW 17 25389422 missense probably damaging 0.99
R5067:Cacna1h UTSW 17 25397808 missense probably damaging 1.00
R5077:Cacna1h UTSW 17 25375250 missense probably benign 0.02
R5148:Cacna1h UTSW 17 25387545 missense probably damaging 1.00
R5336:Cacna1h UTSW 17 25392231 missense probably damaging 0.99
R5450:Cacna1h UTSW 17 25383186 missense probably damaging 1.00
R5616:Cacna1h UTSW 17 25377667 missense probably damaging 1.00
R5738:Cacna1h UTSW 17 25387049 missense probably damaging 0.99
R5883:Cacna1h UTSW 17 25376922 missense probably benign 0.00
R5954:Cacna1h UTSW 17 25383201 missense probably damaging 1.00
R5961:Cacna1h UTSW 17 25377272 missense probably benign 0.01
R6110:Cacna1h UTSW 17 25391276 missense probably benign 0.10
R6125:Cacna1h UTSW 17 25385694 missense probably benign 0.00
R6189:Cacna1h UTSW 17 25397844 missense probably damaging 1.00
R6216:Cacna1h UTSW 17 25378819 missense probably damaging 1.00
R6259:Cacna1h UTSW 17 25397656 critical splice acceptor site probably null
R6296:Cacna1h UTSW 17 25383079 missense probably damaging 1.00
R6394:Cacna1h UTSW 17 25387481 missense probably benign 0.32
R6695:Cacna1h UTSW 17 25393740 missense probably damaging 1.00
R6746:Cacna1h UTSW 17 25381550 missense probably damaging 1.00
R6914:Cacna1h UTSW 17 25385039 missense probably benign
R6942:Cacna1h UTSW 17 25385039 missense probably benign
R6955:Cacna1h UTSW 17 25388056 missense probably damaging 1.00
R7041:Cacna1h UTSW 17 25394003 missense probably damaging 0.98
R7120:Cacna1h UTSW 17 25391507 missense probably benign 0.31
R7125:Cacna1h UTSW 17 25383536 missense probably damaging 0.99
R7182:Cacna1h UTSW 17 25377655 missense probably damaging 1.00
R7270:Cacna1h UTSW 17 25384765 missense probably damaging 1.00
R7274:Cacna1h UTSW 17 25378837 missense probably damaging 1.00
R7319:Cacna1h UTSW 17 25389461 missense possibly damaging 0.94
R7406:Cacna1h UTSW 17 25385626 missense possibly damaging 0.56
R7634:Cacna1h UTSW 17 25392109 missense possibly damaging 0.87
R7684:Cacna1h UTSW 17 25389372 missense probably damaging 0.99
R7769:Cacna1h UTSW 17 25385805 missense probably damaging 1.00
R7856:Cacna1h UTSW 17 25389477 missense probably damaging 0.98
R7876:Cacna1h UTSW 17 25375251 missense probably benign
R7898:Cacna1h UTSW 17 25392276 missense probably damaging 1.00
R8038:Cacna1h UTSW 17 25375891 missense probably damaging 0.97
R8042:Cacna1h UTSW 17 25392471 nonsense probably null
R8139:Cacna1h UTSW 17 25383723 missense probably damaging 1.00
R8391:Cacna1h UTSW 17 25377230 missense probably benign 0.00
V1662:Cacna1h UTSW 17 25377309 missense possibly damaging 0.68
Z1176:Cacna1h UTSW 17 25391250 missense probably benign
Z1177:Cacna1h UTSW 17 25375892 missense probably damaging 1.00
Z1177:Cacna1h UTSW 17 25391378 missense probably damaging 0.99
Z1177:Cacna1h UTSW 17 25393584 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ACTGGTCACTAACGCTCCTG -3'
(R):5'- TATAGACAGGCTCCATCCTCAG -3'

Sequencing Primer
(F):5'- TAACGCTCCTGCCCAGAG -3'
(R):5'- AGGCTCCATCCTCAGCAGATG -3'
Posted On2014-10-02