Mutagenetix > Incidental Mutation

Incidental Mutation 'R2204:Speg'

238871

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

040206-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2204 (G1)

Quality Score

173

Status

Not validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 75430477 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 3137 (T3137S)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000087122
AA Change: T3137S

PolyPhen 2 Score 0.299 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T3137S

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: T2884S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143679

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
A630076J17Rik	A	G	3: 107,233,627		probably benign	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Acsf3	C	T	8: 122,813,644	S527F	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ankrd2	C	A	19: 42,044,119	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Bap1	T	C	14: 31,256,701	V23A	probably benign	Het
C87499	A	T	4: 88,628,118	L329Q	probably damaging	Het
Cartpt	A	T	13: 99,900,625	S4T	probably benign	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Ceacam11	C	T	7: 17,975,348	T157I	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Chrnb4	G	A	9: 55,043,848	R44C	probably damaging	Het
Col6a4	T	C	9: 106,060,132	D1395G	probably damaging	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Espl1	A	G	15: 102,305,905	E693G	probably damaging	Het
Fat1	G	T	8: 45,023,700	A1928S	probably damaging	Het
Fiz1	C	T	7: 5,008,686	E278K	probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Hlcs	T	C	16: 94,231,152	T451A	probably benign	Het
Hmgcr	A	G	13: 96,656,633	L497P	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,341	E239K	probably benign	Het
Ift52	G	A	2: 163,031,230	S221N	probably benign	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Map3k14	T	A	11: 103,239,454	K212N	possibly damaging	Het
Ndufb7	A	G	8: 83,570,899	H61R	probably damaging	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr418	T	A	1: 173,270,136		probably null	Het
Olfr867	T	C	9: 20,055,211	N84S	possibly damaging	Het
P3h4	G	A	11: 100,414,006	A185V	probably benign	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Sars2	T	C	7: 28,749,674	V302A	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stard9	GAAA	GAA	2: 120,698,531		probably null	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Taco1	C	T	11: 106,071,934	A149V	probably benign	Het
Tenm3	T	C	8: 48,674,550	E31G	probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trabd2b	T	C	4: 114,602,994	L443P	probably damaging	Het
Trip4	T	A	9: 65,864,265	I328F	probably damaging	Het
Trpc3	A	G	3: 36,650,149	F553S	possibly damaging	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGCTTTGGTAACGGCCAC -3'
(R):5'- ATTCATGTAGGACATCTGGAAGGG -3'

Sequencing Primer
(F):5'- ACGGTCCTGCTTCTTACGG -3'
(R):5'- CAGGGATAATGCCACTTTGC -3'

Posted On

2014-10-02