Incidental Mutation 'R2204:Shroom3'
ID 238900
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 040206-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2204 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 93090945 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik A G 3: 107,140,943 (GRCm39) probably benign Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Acsf3 C T 8: 123,540,383 (GRCm39) S527F probably damaging Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ankrd2 C A 19: 42,032,558 (GRCm39) A273E probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Bap1 T C 14: 30,978,658 (GRCm39) V23A probably benign Het
Cartpt A T 13: 100,037,133 (GRCm39) S4T probably benign Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Ceacam11 C T 7: 17,709,273 (GRCm39) T157I possibly damaging Het
Cfap45 T C 1: 172,359,728 (GRCm39) V76A probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Chrnb4 G A 9: 54,951,132 (GRCm39) R44C probably damaging Het
Col6a4 T C 9: 105,937,331 (GRCm39) D1395G probably damaging Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Espl1 A G 15: 102,214,340 (GRCm39) E693G probably damaging Het
Fat1 G T 8: 45,476,737 (GRCm39) A1928S probably damaging Het
Fiz1 C T 7: 5,011,685 (GRCm39) E278K probably benign Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Hlcs T C 16: 94,032,011 (GRCm39) T451A probably benign Het
Hmgcr A G 13: 96,793,141 (GRCm39) L497P probably damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Ifit1bl1 C T 19: 34,571,741 (GRCm39) E239K probably benign Het
Ift52 G A 2: 162,873,150 (GRCm39) S221N probably benign Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Map3k14 T A 11: 103,130,280 (GRCm39) K212N possibly damaging Het
Ndufb7 A G 8: 84,297,528 (GRCm39) H61R probably damaging Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10j2 T A 1: 173,097,703 (GRCm39) probably null Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Or7d11 T C 9: 19,966,507 (GRCm39) N84S possibly damaging Het
P3h4 G A 11: 100,304,832 (GRCm39) A185V probably benign Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Pramel32 A T 4: 88,546,355 (GRCm39) L329Q probably damaging Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sars2 T C 7: 28,449,099 (GRCm39) V302A possibly damaging Het
Spata31d1d A G 13: 59,879,435 (GRCm39) C34R possibly damaging Het
Speg A T 1: 75,407,121 (GRCm39) T3137S probably benign Het
Ssh3 A G 19: 4,319,101 (GRCm39) L3P probably damaging Het
Stard9 GAAA GAA 2: 120,529,012 (GRCm39) probably null Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Taco1 C T 11: 105,962,760 (GRCm39) A149V probably benign Het
Tenm3 T C 8: 49,127,585 (GRCm39) E31G probably benign Het
Tmc1 A T 19: 20,918,269 (GRCm39) L2M probably benign Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Tnfsf14 T C 17: 57,497,638 (GRCm39) D198G possibly damaging Het
Trabd2b T C 4: 114,460,191 (GRCm39) L443P probably damaging Het
Trip4 T A 9: 65,771,547 (GRCm39) I328F probably damaging Het
Trpc3 A G 3: 36,704,298 (GRCm39) F553S possibly damaging Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfyve27 C A 19: 42,171,885 (GRCm39) A139D probably damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- GTCTTAACTGTCAGAACGGTAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On 2014-10-02