Incidental Mutation 'R2204:Shroom3'
ID238900
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Nameshroom family member 3
SynonymsD5Ertd287e, Shrm3, Shrm
MMRRC Submission 040206-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2204 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location92683435-92965318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 92943086 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1151 (V1151F)
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]
Predicted Effect probably damaging
Transcript: ENSMUST00000113051
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113054
AA Change: V1057F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: V1057F

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113055
AA Change: V1232F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: V1232F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168878
AA Change: V1101F
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: V1101F

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172706
SMART Domains Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201800
Predicted Effect probably damaging
Transcript: ENSMUST00000225438
AA Change: V1151F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
A630076J17Rik A G 3: 107,233,627 probably benign Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Acsf3 C T 8: 122,813,644 S527F probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Bap1 T C 14: 31,256,701 V23A probably benign Het
C87499 A T 4: 88,628,118 L329Q probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Ceacam11 C T 7: 17,975,348 T157I possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Chrnb4 G A 9: 55,043,848 R44C probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Espl1 A G 15: 102,305,905 E693G probably damaging Het
Fat1 G T 8: 45,023,700 A1928S probably damaging Het
Fiz1 C T 7: 5,008,686 E278K probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Hlcs T C 16: 94,231,152 T451A probably benign Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ift52 G A 2: 163,031,230 S221N probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map3k14 T A 11: 103,239,454 K212N possibly damaging Het
Ndufb7 A G 8: 83,570,899 H61R probably damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr418 T A 1: 173,270,136 probably null Het
Olfr867 T C 9: 20,055,211 N84S possibly damaging Het
P3h4 G A 11: 100,414,006 A185V probably benign Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sars2 T C 7: 28,749,674 V302A possibly damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Speg A T 1: 75,430,477 T3137S probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stard9 GAAA GAA 2: 120,698,531 probably null Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Taco1 C T 11: 106,071,934 A149V probably benign Het
Tenm3 T C 8: 48,674,550 E31G probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trabd2b T C 4: 114,602,994 L443P probably damaging Het
Trip4 T A 9: 65,864,265 I328F probably damaging Het
Trpc3 A G 3: 36,650,149 F553S possibly damaging Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7728:Shroom3 UTSW 5 92683707 missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
R7971:Shroom3 UTSW 5 92951074 missense probably damaging 1.00
R8276:Shroom3 UTSW 5 92940480 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGAGCACACTCATCCGTC -3'
(R):5'- GTCTTAACTGTCAGAACGGTAACC -3'

Sequencing Primer
(F):5'- GTGATCGCAGCAGCTCCTTC -3'
(R):5'- AGACATTTATATATCTTTGTGCGGG -3'
Posted On2014-10-02