Incidental Mutation 'R0180:Gbf1'
ID23891
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0180 (G1)
Quality Score186
Status Not validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46285722 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1732 (S1732P)
Ref Sequence ENSEMBL: ENSMUSP00000135062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000175747] [ENSMUST00000176992]
Predicted Effect probably benign
Transcript: ENSMUST00000026254
AA Change: S1790P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224
AA Change: S1790P

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175706
Predicted Effect probably benign
Transcript: ENSMUST00000175747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176576
Predicted Effect probably benign
Transcript: ENSMUST00000176992
AA Change: S1732P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224
AA Change: S1732P

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 89.5%
Validation Efficiency 77% (53/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T A 19: 21,652,639 N24Y probably damaging Het
2810408A11Rik A T 11: 69,898,876 M311K probably benign Het
Ackr2 T C 9: 121,908,916 I119T probably benign Het
Adamtsl3 A G 7: 82,575,990 M336V probably benign Het
Adhfe1 T A 1: 9,563,857 F374I probably benign Het
Apob C T 12: 8,008,285 Q2256* probably null Het
Arg1 T C 10: 24,916,830 I169V probably benign Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
B3gnt5 T A 16: 19,769,100 I23K possibly damaging Het
Casc1 A G 6: 145,183,218 probably benign Het
Catsperg1 A T 7: 29,190,431 probably null Het
Celf3 T A 3: 94,485,340 F115L probably damaging Het
Cep192 T A 18: 67,835,488 H984Q probably damaging Het
Col18a1 A G 10: 77,096,517 V493A probably benign Het
Col5a2 C T 1: 45,411,460 G376S probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Colec12 A G 18: 9,848,890 H356R probably damaging Het
Cracr2a T C 6: 127,604,074 probably null Het
Ctsr T C 13: 61,162,745 H62R probably damaging Het
Cyp4f40 G T 17: 32,659,667 W61L probably benign Het
Dnah9 T G 11: 66,147,290 H140P probably damaging Het
Dnm1 T G 2: 32,327,993 I464L probably damaging Het
Dnmt1 G A 9: 20,908,620 T1409I probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
Efhc1 A G 1: 20,967,489 M297V probably benign Het
Emcn A T 3: 137,418,994 probably null Het
Ephb1 A T 9: 101,927,504 M905K probably damaging Het
Fbxw10 A G 11: 62,853,096 Y276C probably benign Het
Fermt3 C A 19: 7,002,343 S474I possibly damaging Het
Frg1 T A 8: 41,399,068 probably null Het
Gbp8 A C 5: 105,031,276 L119R probably damaging Het
Gldc C T 19: 30,100,817 A927T possibly damaging Het
Gm8836 T A 6: 70,260,405 probably benign Het
Grhl3 C T 4: 135,554,530 V344I probably benign Het
Hhipl1 T A 12: 108,328,070 L745H probably damaging Het
Ido1 T C 8: 24,593,140 I90V possibly damaging Het
Itpr2 T A 6: 146,501,909 probably benign Het
Kif1b T G 4: 149,213,659 S1029R probably damaging Het
Kmt2a G A 9: 44,826,851 probably benign Het
Limk1 T C 5: 134,669,261 N215D probably damaging Het
Lims2 A G 18: 31,956,315 K144E probably benign Het
Mfsd6l A T 11: 68,556,545 Q74L possibly damaging Het
Mroh1 T A 15: 76,428,250 S546T probably damaging Het
Ncbp3 T A 11: 73,064,978 probably null Het
Nlrx1 G A 9: 44,255,459 H776Y possibly damaging Het
Nptxr T C 15: 79,794,403 M228V probably benign Het
Nsf T A 11: 103,930,780 L13F probably damaging Het
Nyap1 T C 5: 137,738,021 E68G probably damaging Het
Olfr550 A G 7: 102,579,032 Y179C probably damaging Het
Olfr9 A T 10: 128,990,834 R307S possibly damaging Het
Pcdhb9 A G 18: 37,402,254 N434D probably damaging Het
Pgm5 T C 19: 24,815,763 D313G probably damaging Het
Pkdcc G A 17: 83,221,870 probably null Het
Pkp1 T C 1: 135,886,800 K261R probably benign Het
Pnpla6 A G 8: 3,524,250 probably null Het
Polr3b A G 10: 84,622,515 T17A probably benign Het
Ppt2 A T 17: 34,626,503 M98K probably damaging Het
Rasal3 T C 17: 32,399,405 D142G probably benign Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Rhbdf1 A T 11: 32,210,042 V153D possibly damaging Het
Slc6a3 C T 13: 73,562,336 T355M probably damaging Het
Snrnp35 A T 5: 124,490,820 probably benign Het
Sorcs2 A T 5: 36,153,845 I37N probably damaging Het
Tecta G T 9: 42,366,813 P1133Q probably benign Het
Tmem145 A G 7: 25,314,699 I413V probably benign Het
Trappc11 G T 8: 47,527,974 T144K possibly damaging Het
Triml2 A T 8: 43,190,309 I223L probably benign Het
Ube2g2 T A 10: 77,630,739 N19K possibly damaging Het
Ubqln3 A G 7: 104,141,840 Y348H probably damaging Het
Wfs1 A G 5: 36,967,028 F840L probably damaging Het
Zc3h11a T C 1: 133,621,611 I771V probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp106 T G 2: 120,533,875 T684P probably damaging Het
Zfp217 A T 2: 170,120,137 L90Q probably damaging Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
PIT4651001:Gbf1 UTSW 19 46163543 missense probably benign
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1463:Gbf1 UTSW 19 46271545 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
R7313:Gbf1 UTSW 19 46280354 missense possibly damaging 0.94
R7414:Gbf1 UTSW 19 46283358 nonsense probably null
R7646:Gbf1 UTSW 19 46283672 missense probably damaging 1.00
R7650:Gbf1 UTSW 19 46272539 missense probably damaging 1.00
R7789:Gbf1 UTSW 19 46254002 missense probably damaging 1.00
R7801:Gbf1 UTSW 19 46272643 missense probably benign 0.03
R8241:Gbf1 UTSW 19 46246137 missense probably damaging 1.00
Z1177:Gbf1 UTSW 19 46259142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTTCCAACATTATAGCCTGGGAGAG -3'
(R):5'- GAAGCAGAGTCTTGAACGCCTGATAG -3'

Sequencing Primer
(F):5'- CCTGGGAGAGGACTAGGG -3'
(R):5'- TAGGAAGGAATGGTCCTGATCTC -3'
Posted On2013-04-16