Incidental Mutation 'R2204:Chrnb4'
ID238917
Institutional Source Beutler Lab
Gene Symbol Chrnb4
Ensembl Gene ENSMUSG00000035200
Gene Namecholinergic receptor, nicotinic, beta polypeptide 4
SynonymsAcrb-4, Acrb4
MMRRC Submission 040206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2204 (G1)
Quality Score224
Status Not validated
Chromosome9
Chromosomal Location55028154-55048779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55043848 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 44 (R44C)
Ref Sequence ENSEMBL: ENSMUSP00000034854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034854]
Predicted Effect probably damaging
Transcript: ENSMUST00000034854
AA Change: R44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034854
Gene: ENSMUSG00000035200
AA Change: R44C

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 231 3.2e-70 PFAM
Pfam:Neur_chan_memb 238 481 6.1e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217609
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in hyperplasia of the bladder and altered bladder contractility. Mutant mice also exhibit a resistance to nicotine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
A630076J17Rik A G 3: 107,233,627 probably benign Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Acsf3 C T 8: 122,813,644 S527F probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Bap1 T C 14: 31,256,701 V23A probably benign Het
C87499 A T 4: 88,628,118 L329Q probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Ceacam11 C T 7: 17,975,348 T157I possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Espl1 A G 15: 102,305,905 E693G probably damaging Het
Fat1 G T 8: 45,023,700 A1928S probably damaging Het
Fiz1 C T 7: 5,008,686 E278K probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Hlcs T C 16: 94,231,152 T451A probably benign Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ift52 G A 2: 163,031,230 S221N probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map3k14 T A 11: 103,239,454 K212N possibly damaging Het
Ndufb7 A G 8: 83,570,899 H61R probably damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr418 T A 1: 173,270,136 probably null Het
Olfr867 T C 9: 20,055,211 N84S possibly damaging Het
P3h4 G A 11: 100,414,006 A185V probably benign Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sars2 T C 7: 28,749,674 V302A possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Speg A T 1: 75,430,477 T3137S probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stard9 GAAA GAA 2: 120,698,531 probably null Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Taco1 C T 11: 106,071,934 A149V probably benign Het
Tenm3 T C 8: 48,674,550 E31G probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trabd2b T C 4: 114,602,994 L443P probably damaging Het
Trip4 T A 9: 65,864,265 I328F probably damaging Het
Trpc3 A G 3: 36,650,149 F553S possibly damaging Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Other mutations in Chrnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Chrnb4 APN 9 55036594 missense probably damaging 1.00
IGL02207:Chrnb4 APN 9 55035216 missense probably damaging 1.00
IGL03242:Chrnb4 APN 9 55035528 missense probably damaging 1.00
R0345:Chrnb4 UTSW 9 55035594 missense probably benign
R0735:Chrnb4 UTSW 9 55043800 missense probably damaging 0.96
R1843:Chrnb4 UTSW 9 55034818 missense possibly damaging 0.93
R1975:Chrnb4 UTSW 9 55034818 missense probably damaging 0.99
R2427:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R3876:Chrnb4 UTSW 9 55043898 missense probably damaging 1.00
R4934:Chrnb4 UTSW 9 55034817 missense probably benign 0.00
R5094:Chrnb4 UTSW 9 55035313 missense probably benign 0.00
R5507:Chrnb4 UTSW 9 55035012 missense probably damaging 1.00
R6370:Chrnb4 UTSW 9 55034859 missense probably benign 0.00
R7556:Chrnb4 UTSW 9 55035055 missense probably benign 0.19
R8399:Chrnb4 UTSW 9 55043823 missense probably benign 0.02
X0062:Chrnb4 UTSW 9 55034680 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCATCTGTCAAGGTCAGAAGTAAC -3'
(R):5'- TACATAGCTCCAGGGCTCCTAC -3'

Sequencing Primer
(F):5'- TCAAGGTCAGAAGTAACATGCCTGTC -3'
(R):5'- AGGGCTCCTACACTCTGC -3'
Posted On2014-10-02