Incidental Mutation 'R2204:Spata31d1d'
ID 238928
Institutional Source Beutler Lab
Gene Symbol Spata31d1d
Ensembl Gene ENSMUSG00000043986
Gene Name spermatogenesis associated 31 subfamily D, member 1D
Synonyms 4932411G14Rik, Fam75d1d
MMRRC Submission 040206-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2204 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 59873739-59879566 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59879435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 34 (C34R)
Ref Sequence ENSEMBL: ENSMUSP00000128200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052978]
AlphaFold E9Q5W2
Predicted Effect possibly damaging
Transcript: ENSMUST00000052978
AA Change: C34R

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128200
Gene: ENSMUSG00000043986
AA Change: C34R

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:DUF4599 70 155 5.4e-28 PFAM
low complexity region 228 238 N/A INTRINSIC
low complexity region 284 298 N/A INTRINSIC
Pfam:FAM75 383 733 2.6e-93 PFAM
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1111 1129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik A G 3: 107,140,943 (GRCm39) probably benign Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Acsf3 C T 8: 123,540,383 (GRCm39) S527F probably damaging Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ankrd2 C A 19: 42,032,558 (GRCm39) A273E probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Bap1 T C 14: 30,978,658 (GRCm39) V23A probably benign Het
Cartpt A T 13: 100,037,133 (GRCm39) S4T probably benign Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Ceacam11 C T 7: 17,709,273 (GRCm39) T157I possibly damaging Het
Cfap45 T C 1: 172,359,728 (GRCm39) V76A probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Chrnb4 G A 9: 54,951,132 (GRCm39) R44C probably damaging Het
Col6a4 T C 9: 105,937,331 (GRCm39) D1395G probably damaging Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Espl1 A G 15: 102,214,340 (GRCm39) E693G probably damaging Het
Fat1 G T 8: 45,476,737 (GRCm39) A1928S probably damaging Het
Fiz1 C T 7: 5,011,685 (GRCm39) E278K probably benign Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Hlcs T C 16: 94,032,011 (GRCm39) T451A probably benign Het
Hmgcr A G 13: 96,793,141 (GRCm39) L497P probably damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Ifit1bl1 C T 19: 34,571,741 (GRCm39) E239K probably benign Het
Ift52 G A 2: 162,873,150 (GRCm39) S221N probably benign Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Map3k14 T A 11: 103,130,280 (GRCm39) K212N possibly damaging Het
Ndufb7 A G 8: 84,297,528 (GRCm39) H61R probably damaging Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10j2 T A 1: 173,097,703 (GRCm39) probably null Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Or7d11 T C 9: 19,966,507 (GRCm39) N84S possibly damaging Het
P3h4 G A 11: 100,304,832 (GRCm39) A185V probably benign Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Pramel32 A T 4: 88,546,355 (GRCm39) L329Q probably damaging Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sars2 T C 7: 28,449,099 (GRCm39) V302A possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Speg A T 1: 75,407,121 (GRCm39) T3137S probably benign Het
Ssh3 A G 19: 4,319,101 (GRCm39) L3P probably damaging Het
Stard9 GAAA GAA 2: 120,529,012 (GRCm39) probably null Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Taco1 C T 11: 105,962,760 (GRCm39) A149V probably benign Het
Tenm3 T C 8: 49,127,585 (GRCm39) E31G probably benign Het
Tmc1 A T 19: 20,918,269 (GRCm39) L2M probably benign Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Tnfsf14 T C 17: 57,497,638 (GRCm39) D198G possibly damaging Het
Trabd2b T C 4: 114,460,191 (GRCm39) L443P probably damaging Het
Trip4 T A 9: 65,771,547 (GRCm39) I328F probably damaging Het
Trpc3 A G 3: 36,704,298 (GRCm39) F553S possibly damaging Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfyve27 C A 19: 42,171,885 (GRCm39) A139D probably damaging Het
Other mutations in Spata31d1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Spata31d1d APN 13 59,878,029 (GRCm39) splice site probably benign
IGL02399:Spata31d1d APN 13 59,877,954 (GRCm39) splice site probably benign
IGL02531:Spata31d1d APN 13 59,875,748 (GRCm39) missense possibly damaging 0.86
IGL02687:Spata31d1d APN 13 59,875,678 (GRCm39) missense possibly damaging 0.71
IGL02815:Spata31d1d APN 13 59,874,678 (GRCm39) missense possibly damaging 0.72
IGL02893:Spata31d1d APN 13 59,873,793 (GRCm39) missense possibly damaging 0.72
IGL03037:Spata31d1d APN 13 59,873,947 (GRCm39) missense possibly damaging 0.86
IGL02796:Spata31d1d UTSW 13 59,876,057 (GRCm39) missense possibly damaging 0.93
R0612:Spata31d1d UTSW 13 59,875,787 (GRCm39) missense probably benign 0.06
R1345:Spata31d1d UTSW 13 59,873,838 (GRCm39) missense possibly damaging 0.72
R1572:Spata31d1d UTSW 13 59,876,005 (GRCm39) missense probably benign 0.01
R1736:Spata31d1d UTSW 13 59,874,311 (GRCm39) missense probably benign 0.02
R1750:Spata31d1d UTSW 13 59,876,509 (GRCm39) missense probably benign 0.33
R1894:Spata31d1d UTSW 13 59,875,936 (GRCm39) missense probably benign 0.09
R2202:Spata31d1d UTSW 13 59,879,435 (GRCm39) missense possibly damaging 0.82
R2203:Spata31d1d UTSW 13 59,879,435 (GRCm39) missense possibly damaging 0.82
R2913:Spata31d1d UTSW 13 59,874,769 (GRCm39) missense possibly damaging 0.72
R3942:Spata31d1d UTSW 13 59,875,276 (GRCm39) missense probably benign 0.18
R4513:Spata31d1d UTSW 13 59,876,368 (GRCm39) missense probably benign 0.32
R4824:Spata31d1d UTSW 13 59,877,055 (GRCm39) missense possibly damaging 0.86
R4959:Spata31d1d UTSW 13 59,875,102 (GRCm39) missense probably damaging 1.00
R4970:Spata31d1d UTSW 13 59,875,334 (GRCm39) missense probably benign 0.33
R5406:Spata31d1d UTSW 13 59,876,592 (GRCm39) missense probably benign 0.33
R5618:Spata31d1d UTSW 13 59,874,214 (GRCm39) missense probably benign 0.01
R5688:Spata31d1d UTSW 13 59,874,322 (GRCm39) missense probably damaging 0.98
R5741:Spata31d1d UTSW 13 59,876,500 (GRCm39) missense possibly damaging 0.86
R5867:Spata31d1d UTSW 13 59,875,054 (GRCm39) missense possibly damaging 0.53
R5930:Spata31d1d UTSW 13 59,874,829 (GRCm39) missense probably benign
R6263:Spata31d1d UTSW 13 59,873,797 (GRCm39) missense probably benign 0.18
R6267:Spata31d1d UTSW 13 59,876,278 (GRCm39) missense possibly damaging 0.93
R6296:Spata31d1d UTSW 13 59,876,278 (GRCm39) missense possibly damaging 0.93
R6597:Spata31d1d UTSW 13 59,873,871 (GRCm39) missense probably benign 0.01
R6985:Spata31d1d UTSW 13 59,879,429 (GRCm39) missense probably benign 0.00
R7032:Spata31d1d UTSW 13 59,876,046 (GRCm39) missense probably benign
R7174:Spata31d1d UTSW 13 59,876,394 (GRCm39) missense possibly damaging 0.72
R7322:Spata31d1d UTSW 13 59,874,790 (GRCm39) missense probably benign
R7444:Spata31d1d UTSW 13 59,875,007 (GRCm39) missense probably benign 0.33
R7946:Spata31d1d UTSW 13 59,878,606 (GRCm39) missense probably benign 0.02
R8206:Spata31d1d UTSW 13 59,879,344 (GRCm39) missense probably benign 0.03
R8912:Spata31d1d UTSW 13 59,875,136 (GRCm39) missense possibly damaging 0.53
R8995:Spata31d1d UTSW 13 59,874,421 (GRCm39) missense probably benign 0.33
R9215:Spata31d1d UTSW 13 59,875,823 (GRCm39) missense probably benign 0.32
R9800:Spata31d1d UTSW 13 59,874,637 (GRCm39) missense possibly damaging 0.53
Z1176:Spata31d1d UTSW 13 59,873,981 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CCTCTCCACAGTATCGTAACAG -3'
(R):5'- TTCCCTGCTCTGTGATGCAG -3'

Sequencing Primer
(F):5'- AGTATCGTAACAGCTCAGGTAC -3'
(R):5'- AGGCCTGCCCACTTACAG -3'
Posted On 2014-10-02