Incidental Mutation 'R2204:Bap1'
ID238931
Institutional Source Beutler Lab
Gene Symbol Bap1
Ensembl Gene ENSMUSG00000021901
Gene NameBrca1 associated protein 1
Synonyms2300006C11Rik
MMRRC Submission 040206-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2204 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31251450-31259944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31256701 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 23 (V23A)
Ref Sequence ENSEMBL: ENSMUSP00000139903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022458] [ENSMUST00000048603] [ENSMUST00000187156] [ENSMUST00000188453]
Predicted Effect probably benign
Transcript: ENSMUST00000022458
AA Change: V386A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022458
Gene: ENSMUSG00000021901
AA Change: V386A

DomainStartEndE-ValueType
Pfam:Peptidase_C12 5 215 3e-70 PFAM
low complexity region 282 293 N/A INTRINSIC
low complexity region 396 407 N/A INTRINSIC
low complexity region 577 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048603
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185987
Predicted Effect probably benign
Transcript: ENSMUST00000187156
AA Change: V23A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139903
Gene: ENSMUSG00000021901
AA Change: V23A

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188453
SMART Domains Protein: ENSMUSP00000139824
Gene: ENSMUSG00000021901

DomainStartEndE-ValueType
Pfam:Peptidase_C12 4 137 3.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190788
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous deletion of this gene causes delayed embryonic growth and complete lethality during organogenesis. Systemic or hematopoietic-restricted deletion in adults recapitulates features of myelodysplastic syndrome. Heterozygotes show increased incidence of asbestos-induced malignant mesothelioma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
A630076J17Rik A G 3: 107,233,627 probably benign Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Acsf3 C T 8: 122,813,644 S527F probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
C87499 A T 4: 88,628,118 L329Q probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Ceacam11 C T 7: 17,975,348 T157I possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Chrnb4 G A 9: 55,043,848 R44C probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Espl1 A G 15: 102,305,905 E693G probably damaging Het
Fat1 G T 8: 45,023,700 A1928S probably damaging Het
Fiz1 C T 7: 5,008,686 E278K probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Hlcs T C 16: 94,231,152 T451A probably benign Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ift52 G A 2: 163,031,230 S221N probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map3k14 T A 11: 103,239,454 K212N possibly damaging Het
Ndufb7 A G 8: 83,570,899 H61R probably damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr418 T A 1: 173,270,136 probably null Het
Olfr867 T C 9: 20,055,211 N84S possibly damaging Het
P3h4 G A 11: 100,414,006 A185V probably benign Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sars2 T C 7: 28,749,674 V302A possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Speg A T 1: 75,430,477 T3137S probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stard9 GAAA GAA 2: 120,698,531 probably null Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Taco1 C T 11: 106,071,934 A149V probably benign Het
Tenm3 T C 8: 48,674,550 E31G probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trabd2b T C 4: 114,602,994 L443P probably damaging Het
Trip4 T A 9: 65,864,265 I328F probably damaging Het
Trpc3 A G 3: 36,650,149 F553S possibly damaging Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfyve27 C A 19: 42,183,446 A139D probably damaging Het
Other mutations in Bap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Bap1 APN 14 31253569 missense probably damaging 0.97
IGL02110:Bap1 APN 14 31257414 missense probably damaging 0.97
IGL02740:Bap1 APN 14 31256772 missense possibly damaging 0.94
IGL02937:Bap1 APN 14 31258327 missense probably benign 0.07
R0138:Bap1 UTSW 14 31256724 missense probably damaging 1.00
R1221:Bap1 UTSW 14 31257651 missense probably damaging 1.00
R2131:Bap1 UTSW 14 31258331 nonsense probably null
R3781:Bap1 UTSW 14 31257618 missense possibly damaging 0.71
R4882:Bap1 UTSW 14 31251721 unclassified probably benign
R4897:Bap1 UTSW 14 31258445 unclassified probably benign
R5249:Bap1 UTSW 14 31257286 unclassified probably benign
R6548:Bap1 UTSW 14 31256225 missense probably benign 0.01
R6990:Bap1 UTSW 14 31255651 missense probably benign
R7203:Bap1 UTSW 14 31254169 missense probably damaging 1.00
R7212:Bap1 UTSW 14 31251623 missense probably damaging 0.99
R7414:Bap1 UTSW 14 31253615 missense probably benign 0.05
R7956:Bap1 UTSW 14 31255568 missense probably benign 0.11
R8062:Bap1 UTSW 14 31257508 missense probably benign 0.38
R8070:Bap1 UTSW 14 31256686 missense probably damaging 1.00
R8875:Bap1 UTSW 14 31253565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGTTGGGTATACTCCTTGGC -3'
(R):5'- TACTGTTCTCTCAGACGCAGG -3'

Sequencing Primer
(F):5'- GGCACATGGGAAAGTTTCTCC -3'
(R):5'- TCTCAGACGCAGGGTGGAATATTG -3'
Posted On2014-10-02