Incidental Mutation 'R2204:Espl1'
ID 238932
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 040206-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2204 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102214340 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 693 (E693G)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: E693G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: E693G

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: E693G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik A G 3: 107,140,943 (GRCm39) probably benign Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Acsf3 C T 8: 123,540,383 (GRCm39) S527F probably damaging Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ankrd2 C A 19: 42,032,558 (GRCm39) A273E probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Bap1 T C 14: 30,978,658 (GRCm39) V23A probably benign Het
Cartpt A T 13: 100,037,133 (GRCm39) S4T probably benign Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Ceacam11 C T 7: 17,709,273 (GRCm39) T157I possibly damaging Het
Cfap45 T C 1: 172,359,728 (GRCm39) V76A probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Chrnb4 G A 9: 54,951,132 (GRCm39) R44C probably damaging Het
Col6a4 T C 9: 105,937,331 (GRCm39) D1395G probably damaging Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Fat1 G T 8: 45,476,737 (GRCm39) A1928S probably damaging Het
Fiz1 C T 7: 5,011,685 (GRCm39) E278K probably benign Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Hlcs T C 16: 94,032,011 (GRCm39) T451A probably benign Het
Hmgcr A G 13: 96,793,141 (GRCm39) L497P probably damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Ifit1bl1 C T 19: 34,571,741 (GRCm39) E239K probably benign Het
Ift52 G A 2: 162,873,150 (GRCm39) S221N probably benign Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Map3k14 T A 11: 103,130,280 (GRCm39) K212N possibly damaging Het
Ndufb7 A G 8: 84,297,528 (GRCm39) H61R probably damaging Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10j2 T A 1: 173,097,703 (GRCm39) probably null Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Or7d11 T C 9: 19,966,507 (GRCm39) N84S possibly damaging Het
P3h4 G A 11: 100,304,832 (GRCm39) A185V probably benign Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Pramel32 A T 4: 88,546,355 (GRCm39) L329Q probably damaging Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sars2 T C 7: 28,449,099 (GRCm39) V302A possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spata31d1d A G 13: 59,879,435 (GRCm39) C34R possibly damaging Het
Speg A T 1: 75,407,121 (GRCm39) T3137S probably benign Het
Ssh3 A G 19: 4,319,101 (GRCm39) L3P probably damaging Het
Stard9 GAAA GAA 2: 120,529,012 (GRCm39) probably null Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Taco1 C T 11: 105,962,760 (GRCm39) A149V probably benign Het
Tenm3 T C 8: 49,127,585 (GRCm39) E31G probably benign Het
Tmc1 A T 19: 20,918,269 (GRCm39) L2M probably benign Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Tnfsf14 T C 17: 57,497,638 (GRCm39) D198G possibly damaging Het
Trabd2b T C 4: 114,460,191 (GRCm39) L443P probably damaging Het
Trip4 T A 9: 65,771,547 (GRCm39) I328F probably damaging Het
Trpc3 A G 3: 36,704,298 (GRCm39) F553S possibly damaging Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfyve27 C A 19: 42,171,885 (GRCm39) A139D probably damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2009:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTATCTTTCTACAGCTCTGC -3'
(R):5'- TCAGGAAGCCTCCAAGATGC -3'

Sequencing Primer
(F):5'- ACAGCTCTGCCTTGGATGCTG -3'
(R):5'- AAGCCTCCAAGATGCCTGTG -3'
Posted On 2014-10-02