Incidental Mutation 'R2204:Tnfsf14'
ID 238936
Institutional Source Beutler Lab
Gene Symbol Tnfsf14
Ensembl Gene ENSMUSG00000005824
Gene Name tumor necrosis factor (ligand) superfamily, member 14
Synonyms LIGHT, HVEM-L
MMRRC Submission 040206-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R2204 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 57496492-57501177 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57497638 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 198 (D198G)
Ref Sequence ENSEMBL: ENSMUSP00000005976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005976]
AlphaFold Q9QYH9
Predicted Effect possibly damaging
Transcript: ENSMUST00000005976
AA Change: D198G

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005976
Gene: ENSMUSG00000005824
AA Change: D198G

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 92 239 1.22e-49 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene leads to selective impairment of CD8+ T cell function. Mice homozygous for a knock-out allele exhibit defects in CD8+ T cell-mediated allogenic responses. Mice homozygous for a different knock-out allele show increased resistance to experimentally-induced hepatitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630076J17Rik A G 3: 107,140,943 (GRCm39) probably benign Het
Abca1 G A 4: 53,090,291 (GRCm39) T386I probably damaging Het
Acsf3 C T 8: 123,540,383 (GRCm39) S527F probably damaging Het
Adamts7 A T 9: 90,062,729 (GRCm39) K394N probably damaging Het
Ankrd2 C A 19: 42,032,558 (GRCm39) A273E probably damaging Het
Ankrd26 T A 6: 118,500,843 (GRCm39) H876L possibly damaging Het
Atg16l1 A C 1: 87,694,737 (GRCm39) Q138P probably benign Het
Bap1 T C 14: 30,978,658 (GRCm39) V23A probably benign Het
Cartpt A T 13: 100,037,133 (GRCm39) S4T probably benign Het
Cdan1 C A 2: 120,551,241 (GRCm39) C1093F probably damaging Het
Ceacam11 C T 7: 17,709,273 (GRCm39) T157I possibly damaging Het
Cfap45 T C 1: 172,359,728 (GRCm39) V76A probably benign Het
Chil3 T C 3: 106,071,562 (GRCm39) D34G probably benign Het
Chrnb4 G A 9: 54,951,132 (GRCm39) R44C probably damaging Het
Col6a4 T C 9: 105,937,331 (GRCm39) D1395G probably damaging Het
Cpa1 A G 6: 30,641,818 (GRCm39) D214G probably damaging Het
Cttnbp2 T G 6: 18,408,693 (GRCm39) D976A probably benign Het
Elapor1 C T 3: 108,382,359 (GRCm39) G270E probably damaging Het
Espl1 A G 15: 102,214,340 (GRCm39) E693G probably damaging Het
Fat1 G T 8: 45,476,737 (GRCm39) A1928S probably damaging Het
Fiz1 C T 7: 5,011,685 (GRCm39) E278K probably benign Het
Flnc C T 6: 29,459,507 (GRCm39) P2536S probably damaging Het
Gm6370 T A 5: 146,430,539 (GRCm39) D241E probably benign Het
Hlcs T C 16: 94,032,011 (GRCm39) T451A probably benign Het
Hmgcr A G 13: 96,793,141 (GRCm39) L497P probably damaging Het
Hmgcs2 T A 3: 98,198,499 (GRCm39) I134N probably damaging Het
Ifit1bl1 C T 19: 34,571,741 (GRCm39) E239K probably benign Het
Ift52 G A 2: 162,873,150 (GRCm39) S221N probably benign Het
Knstrn T A 2: 118,661,456 (GRCm39) probably null Het
Map3k14 T A 11: 103,130,280 (GRCm39) K212N possibly damaging Het
Ndufb7 A G 8: 84,297,528 (GRCm39) H61R probably damaging Het
Nop56 T A 2: 130,119,488 (GRCm39) I51N probably damaging Het
Nudt5 A T 2: 5,860,794 (GRCm39) I22F possibly damaging Het
Or10j2 T A 1: 173,097,703 (GRCm39) probably null Het
Or4p23 C G 2: 88,576,953 (GRCm39) G93A probably benign Het
Or7d11 T C 9: 19,966,507 (GRCm39) N84S possibly damaging Het
P3h4 G A 11: 100,304,832 (GRCm39) A185V probably benign Het
Pdcl A T 2: 37,242,056 (GRCm39) N231K probably benign Het
Plcb4 T C 2: 135,844,514 (GRCm39) I144T probably benign Het
Pramel32 A T 4: 88,546,355 (GRCm39) L329Q probably damaging Het
Prrc2b C A 2: 32,113,476 (GRCm39) Q1970K probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sars2 T C 7: 28,449,099 (GRCm39) V302A possibly damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Spata31d1d A G 13: 59,879,435 (GRCm39) C34R possibly damaging Het
Speg A T 1: 75,407,121 (GRCm39) T3137S probably benign Het
Ssh3 A G 19: 4,319,101 (GRCm39) L3P probably damaging Het
Stard9 GAAA GAA 2: 120,529,012 (GRCm39) probably null Het
Stoml2 G T 4: 43,030,243 (GRCm39) Y119* probably null Het
Susd1 A G 4: 59,349,843 (GRCm39) L531P possibly damaging Het
Taco1 C T 11: 105,962,760 (GRCm39) A149V probably benign Het
Tenm3 T C 8: 49,127,585 (GRCm39) E31G probably benign Het
Tmc1 A T 19: 20,918,269 (GRCm39) L2M probably benign Het
Tmem39b A C 4: 129,587,716 (GRCm39) S32A probably benign Het
Trabd2b T C 4: 114,460,191 (GRCm39) L443P probably damaging Het
Trip4 T A 9: 65,771,547 (GRCm39) I328F probably damaging Het
Trpc3 A G 3: 36,704,298 (GRCm39) F553S possibly damaging Het
Tssk2 A G 16: 17,716,603 (GRCm39) D2G possibly damaging Het
Ttn T C 2: 76,601,985 (GRCm39) N18559S possibly damaging Het
Vmn1r23 T C 6: 57,903,604 (GRCm39) D58G probably benign Het
Zbtb47 A G 9: 121,591,703 (GRCm39) T8A possibly damaging Het
Zfyve27 C A 19: 42,171,885 (GRCm39) A139D probably damaging Het
Other mutations in Tnfsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Tnfsf14 APN 17 57,499,562 (GRCm39) missense possibly damaging 0.89
IGL00962:Tnfsf14 APN 17 57,499,906 (GRCm39) nonsense probably null
IGL02515:Tnfsf14 APN 17 57,499,600 (GRCm39) missense probably benign
P0015:Tnfsf14 UTSW 17 57,497,815 (GRCm39) missense probably damaging 1.00
R1435:Tnfsf14 UTSW 17 57,497,605 (GRCm39) missense possibly damaging 0.60
R1566:Tnfsf14 UTSW 17 57,500,876 (GRCm39) missense probably benign
R1791:Tnfsf14 UTSW 17 57,497,867 (GRCm39) missense probably damaging 1.00
R1967:Tnfsf14 UTSW 17 57,497,807 (GRCm39) missense probably damaging 1.00
R2108:Tnfsf14 UTSW 17 57,497,867 (GRCm39) missense probably damaging 1.00
R2202:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2203:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2205:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2232:Tnfsf14 UTSW 17 57,500,876 (GRCm39) missense probably benign
R4790:Tnfsf14 UTSW 17 57,497,740 (GRCm39) missense probably damaging 1.00
R5434:Tnfsf14 UTSW 17 57,499,592 (GRCm39) missense probably benign 0.00
R7474:Tnfsf14 UTSW 17 57,497,848 (GRCm39) missense
R7691:Tnfsf14 UTSW 17 57,501,024 (GRCm39) missense possibly damaging 0.92
R8499:Tnfsf14 UTSW 17 57,497,534 (GRCm39) missense
R9330:Tnfsf14 UTSW 17 57,501,020 (GRCm39) missense probably damaging 1.00
Z1177:Tnfsf14 UTSW 17 57,501,089 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAGTTCAGGGCTCCTTAAAGG -3'
(R):5'- GTGTACTCCAAAGTGCAGCTG -3'

Sequencing Primer
(F):5'- GAGGACTTCAAACCCTATTGCTGG -3'
(R):5'- CCAAAGTGCAGCTGAGCGG -3'
Posted On 2014-10-02