Mutagenetix > Incidental Mutation

Incidental Mutation 'R2204:Ifit1bl1'

238939

Institutional Source

Beutler Lab

Gene Symbol

Ifit1bl1

Ensembl Gene

ENSMUSG00000079339

Gene Name

interferon induced protein with tetratricpeptide repeats 1B like 1

Synonyms

Gm14446

MMRRC Submission

040206-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2204 (G1)

Quality Score

168

Status

Not validated

Chromosome

Chromosomal Location

34592888-34601968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34594341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 239 (E239K)

Ref Sequence

ENSEMBL: ENSMUSP00000132781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]

AlphaFold

D3Z6F0

Predicted Effect

probably benign
Transcript: ENSMUST00000112467
AA Change: E239K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: E239K

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168254
AA Change: E239K

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: E239K

Domain	Start	End	E-Value	Type
TPR	60	93	3.41e1	SMART
TPR	100	133	6.24e1	SMART
TPR	146	179	3.69e1	SMART
low complexity region	217	231	N/A	INTRINSIC
TPR	249	282	6.75e1	SMART
TPR	338	371	1.64e1	SMART
low complexity region	417	429	N/A	INTRINSIC
TPR	433	466	1.08e1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	C	T	3: 108,475,043	G270E	probably damaging	Het
A630076J17Rik	A	G	3: 107,233,627		probably benign	Het
Abca1	G	A	4: 53,090,291	T386I	probably damaging	Het
Acsf3	C	T	8: 122,813,644	S527F	probably damaging	Het
Adamts7	A	T	9: 90,180,676	K394N	probably damaging	Het
Ankrd2	C	A	19: 42,044,119	A273E	probably damaging	Het
Ankrd26	T	A	6: 118,523,882	H876L	possibly damaging	Het
Atg16l1	A	C	1: 87,767,015	Q138P	probably benign	Het
Bap1	T	C	14: 31,256,701	V23A	probably benign	Het
C87499	A	T	4: 88,628,118	L329Q	probably damaging	Het
Cartpt	A	T	13: 99,900,625	S4T	probably benign	Het
Cdan1	C	A	2: 120,720,760	C1093F	probably damaging	Het
Ceacam11	C	T	7: 17,975,348	T157I	possibly damaging	Het
Cfap45	T	C	1: 172,532,161	V76A	probably benign	Het
Chil3	T	C	3: 106,164,246	D34G	probably benign	Het
Chrnb4	G	A	9: 55,043,848	R44C	probably damaging	Het
Col6a4	T	C	9: 106,060,132	D1395G	probably damaging	Het
Cpa1	A	G	6: 30,641,819	D214G	probably damaging	Het
Cttnbp2	T	G	6: 18,408,694	D976A	probably benign	Het
Espl1	A	G	15: 102,305,905	E693G	probably damaging	Het
Fat1	G	T	8: 45,023,700	A1928S	probably damaging	Het
Fiz1	C	T	7: 5,008,686	E278K	probably benign	Het
Flnc	C	T	6: 29,459,508	P2536S	probably damaging	Het
Gm6370	T	A	5: 146,493,729	D241E	probably benign	Het
Hlcs	T	C	16: 94,231,152	T451A	probably benign	Het
Hmgcr	A	G	13: 96,656,633	L497P	probably damaging	Het
Hmgcs2	T	A	3: 98,291,183	I134N	probably damaging	Het
Ift52	G	A	2: 163,031,230	S221N	probably benign	Het
Knstrn	T	A	2: 118,830,975		probably null	Het
Map3k14	T	A	11: 103,239,454	K212N	possibly damaging	Het
Ndufb7	A	G	8: 83,570,899	H61R	probably damaging	Het
Nop56	T	A	2: 130,277,568	I51N	probably damaging	Het
Nudt5	A	T	2: 5,855,983	I22F	possibly damaging	Het
Olfr1198	C	G	2: 88,746,609	G93A	probably benign	Het
Olfr418	T	A	1: 173,270,136		probably null	Het
Olfr867	T	C	9: 20,055,211	N84S	possibly damaging	Het
P3h4	G	A	11: 100,414,006	A185V	probably benign	Het
Pdcl	A	T	2: 37,352,044	N231K	probably benign	Het
Plcb4	T	C	2: 136,002,594	I144T	probably benign	Het
Prrc2b	C	A	2: 32,223,464	Q1970K	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Sars2	T	C	7: 28,749,674	V302A	possibly damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Spata31d1d	A	G	13: 59,731,621	C34R	possibly damaging	Het
Speg	A	T	1: 75,430,477	T3137S	probably benign	Het
Ssh3	A	G	19: 4,269,073	L3P	probably damaging	Het
Stard9	GAAA	GAA	2: 120,698,531		probably null	Het
Stoml2	G	T	4: 43,030,243	Y119*	probably null	Het
Susd1	A	G	4: 59,349,843	L531P	possibly damaging	Het
Taco1	C	T	11: 106,071,934	A149V	probably benign	Het
Tenm3	T	C	8: 48,674,550	E31G	probably benign	Het
Tmc1	A	T	19: 20,940,905	L2M	probably benign	Het
Tmem39b	A	C	4: 129,693,923	S32A	probably benign	Het
Tnfsf14	T	C	17: 57,190,638	D198G	possibly damaging	Het
Trabd2b	T	C	4: 114,602,994	L443P	probably damaging	Het
Trip4	T	A	9: 65,864,265	I328F	probably damaging	Het
Trpc3	A	G	3: 36,650,149	F553S	possibly damaging	Het
Tssk2	A	G	16: 17,898,739	D2G	possibly damaging	Het
Ttn	T	C	2: 76,771,641	N18559S	possibly damaging	Het
Vmn1r23	T	C	6: 57,926,619	D58G	probably benign	Het
Zfp651	A	G	9: 121,762,637	T8A	possibly damaging	Het
Zfyve27	C	A	19: 42,183,446	A139D	probably damaging	Het

Other mutations in Ifit1bl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4544001:Ifit1bl1	UTSW	19	34594015	missense	possibly damaging	0.79
R0420:Ifit1bl1	UTSW	19	34594514	missense	probably damaging	1.00
R1161:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1310:Ifit1bl1	UTSW	19	34593696	missense	possibly damaging	0.80
R1483:Ifit1bl1	UTSW	19	34594641	missense	possibly damaging	0.88
R1606:Ifit1bl1	UTSW	19	34594044	missense	probably benign	0.00
R1753:Ifit1bl1	UTSW	19	34593860	missense	probably benign	0.15
R1778:Ifit1bl1	UTSW	19	34594193	missense	probably damaging	1.00
R2205:Ifit1bl1	UTSW	19	34594341	missense	probably benign	0.23
R2442:Ifit1bl1	UTSW	19	34594889	missense	probably benign	0.00
R2858:Ifit1bl1	UTSW	19	34594322	missense	probably benign	0.01
R3422:Ifit1bl1	UTSW	19	34593950	missense	probably benign	0.04
R4081:Ifit1bl1	UTSW	19	34594640	missense	possibly damaging	0.63
R4125:Ifit1bl1	UTSW	19	34594788	missense	probably damaging	0.99
R4616:Ifit1bl1	UTSW	19	34594610	missense	probably damaging	1.00
R4731:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4732:Ifit1bl1	UTSW	19	34594321	missense	probably benign	0.02
R4849:Ifit1bl1	UTSW	19	34594676	missense	probably damaging	1.00
R5026:Ifit1bl1	UTSW	19	34593893	missense	probably damaging	1.00
R5049:Ifit1bl1	UTSW	19	34594081	nonsense	probably null
R5414:Ifit1bl1	UTSW	19	34593924	missense	probably damaging	0.99
R5561:Ifit1bl1	UTSW	19	34593797	nonsense	probably null
R5586:Ifit1bl1	UTSW	19	34594277	missense	probably damaging	0.98
R6345:Ifit1bl1	UTSW	19	34594170	nonsense	probably null
R6382:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R6515:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R7073:Ifit1bl1	UTSW	19	34599267	critical splice donor site	probably null
R7180:Ifit1bl1	UTSW	19	34593902	missense	probably damaging	1.00
R7210:Ifit1bl1	UTSW	19	34594164	missense	probably benign	0.00
R7665:Ifit1bl1	UTSW	19	34594883	missense	probably benign	0.16
R7724:Ifit1bl1	UTSW	19	34594005	missense	probably benign	0.00
R7783:Ifit1bl1	UTSW	19	34593936	missense	probably benign	0.01
R7944:Ifit1bl1	UTSW	19	34593824	missense	probably benign	0.00
R8251:Ifit1bl1	UTSW	19	34594832	missense	possibly damaging	0.85
R8427:Ifit1bl1	UTSW	19	34599266	critical splice donor site	probably null
R8474:Ifit1bl1	UTSW	19	34594862	missense	probably damaging	1.00
R8933:Ifit1bl1	UTSW	19	34594013	missense	probably damaging	0.99
R9095:Ifit1bl1	UTSW	19	34594499	missense	probably damaging	1.00
R9282:Ifit1bl1	UTSW	19	34594508	missense	probably benign	0.28
R9314:Ifit1bl1	UTSW	19	34599293	missense	probably benign	0.08
R9432:Ifit1bl1	UTSW	19	34594098	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AGTCGTTTCTTATGGCAAAGGC -3'
(R):5'- TATAAAGGAGCCATGGCCTGC -3'

Sequencing Primer
(F):5'- CAAAGGCCAATCTGGAAATGC -3'
(R):5'- CTGCTTTGCAAAGGCTCTGAAAG -3'

Posted On

2014-10-02