Incidental Mutation 'R2204:Zfyve27'
ID238941
Institutional Source Beutler Lab
Gene Symbol Zfyve27
Ensembl Gene ENSMUSG00000018820
Gene Namezinc finger, FYVE domain containing 27
Synonymsprotrudin, 2210011N02Rik, 9530077C24Rik
MMRRC Submission 040206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2204 (G1)
Quality Score185
Status Not validated
Chromosome19
Chromosomal Location42163951-42194590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42183446 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 139 (A139D)
Ref Sequence ENSEMBL: ENSMUSP00000129561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099443] [ENSMUST00000168130] [ENSMUST00000169536]
Predicted Effect probably damaging
Transcript: ENSMUST00000099443
AA Change: A233D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097042
Gene: ENSMUSG00000018820
AA Change: A233D

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
FYVE 335 408 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165783
Predicted Effect probably damaging
Transcript: ENSMUST00000168130
AA Change: A139D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129561
Gene: ENSMUSG00000018820
AA Change: A139D

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169536
AA Change: A233D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820
AA Change: A233D

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170184
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several transmembrane domains, a Rab11-binding domain and a lipid-binding FYVE finger domain. The encoded protein appears to promote neurite formation. A mutation in this gene has been reported to be associated with hereditary spastic paraplegia, however the pathogenicity of the mutation, which may simply represent a polymorphism, is unclear. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
A630076J17Rik A G 3: 107,233,627 probably benign Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Acsf3 C T 8: 122,813,644 S527F probably damaging Het
Adamts7 A T 9: 90,180,676 K394N probably damaging Het
Ankrd2 C A 19: 42,044,119 A273E probably damaging Het
Ankrd26 T A 6: 118,523,882 H876L possibly damaging Het
Atg16l1 A C 1: 87,767,015 Q138P probably benign Het
Bap1 T C 14: 31,256,701 V23A probably benign Het
C87499 A T 4: 88,628,118 L329Q probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Ceacam11 C T 7: 17,975,348 T157I possibly damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Chil3 T C 3: 106,164,246 D34G probably benign Het
Chrnb4 G A 9: 55,043,848 R44C probably damaging Het
Col6a4 T C 9: 106,060,132 D1395G probably damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Espl1 A G 15: 102,305,905 E693G probably damaging Het
Fat1 G T 8: 45,023,700 A1928S probably damaging Het
Fiz1 C T 7: 5,008,686 E278K probably benign Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Hlcs T C 16: 94,231,152 T451A probably benign Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Ifit1bl1 C T 19: 34,594,341 E239K probably benign Het
Ift52 G A 2: 163,031,230 S221N probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map3k14 T A 11: 103,239,454 K212N possibly damaging Het
Ndufb7 A G 8: 83,570,899 H61R probably damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Olfr418 T A 1: 173,270,136 probably null Het
Olfr867 T C 9: 20,055,211 N84S possibly damaging Het
P3h4 G A 11: 100,414,006 A185V probably benign Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sars2 T C 7: 28,749,674 V302A possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Speg A T 1: 75,430,477 T3137S probably benign Het
Ssh3 A G 19: 4,269,073 L3P probably damaging Het
Stard9 GAAA GAA 2: 120,698,531 probably null Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Taco1 C T 11: 106,071,934 A149V probably benign Het
Tenm3 T C 8: 48,674,550 E31G probably benign Het
Tmc1 A T 19: 20,940,905 L2M probably benign Het
Tmem39b A C 4: 129,693,923 S32A probably benign Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Trabd2b T C 4: 114,602,994 L443P probably damaging Het
Trip4 T A 9: 65,864,265 I328F probably damaging Het
Trpc3 A G 3: 36,650,149 F553S possibly damaging Het
Tssk2 A G 16: 17,898,739 D2G possibly damaging Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn1r23 T C 6: 57,926,619 D58G probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Other mutations in Zfyve27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Zfyve27 APN 19 42183433 missense probably benign
IGL02040:Zfyve27 APN 19 42179391 missense probably damaging 1.00
IGL02048:Zfyve27 APN 19 42185857 missense probably damaging 0.99
IGL02135:Zfyve27 APN 19 42184136 missense probably damaging 1.00
Forgotten UTSW 19 42189577 missense probably damaging 1.00
ignored UTSW 19 42171731 missense probably benign 0.01
overlooked UTSW 19 42182657 critical splice acceptor site probably null
R0388:Zfyve27 UTSW 19 42189585 missense probably damaging 1.00
R1589:Zfyve27 UTSW 19 42171745 critical splice donor site probably null
R1908:Zfyve27 UTSW 19 42171548 start codon destroyed probably null 1.00
R2151:Zfyve27 UTSW 19 42171731 missense probably benign 0.01
R2205:Zfyve27 UTSW 19 42183446 missense probably damaging 1.00
R5800:Zfyve27 UTSW 19 42182663 missense probably damaging 1.00
R5819:Zfyve27 UTSW 19 42183496 missense probably benign 0.00
R5870:Zfyve27 UTSW 19 42171671 missense probably benign 0.01
R5959:Zfyve27 UTSW 19 42179448 missense unknown
R6217:Zfyve27 UTSW 19 42189577 missense probably damaging 1.00
R6281:Zfyve27 UTSW 19 42182755 missense probably damaging 1.00
R6337:Zfyve27 UTSW 19 42182657 critical splice acceptor site probably null
R6638:Zfyve27 UTSW 19 42181497 splice site probably null
R7438:Zfyve27 UTSW 19 42189520 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCACTGGCCGACTCTTTGTAG -3'
(R):5'- TGTGCCTCATAAACACATCGC -3'

Sequencing Primer
(F):5'- CCGACTCTTTGTAGCCGTGG -3'
(R):5'- TAAACACATCGCTAAGAATAAGAGGG -3'
Posted On2014-10-02